Details for gene: CRX


DNA binding : Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid). ; regulation of transcription, DNA-templated : Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; DNA-binding transcription factor activity : A transcription regulator activity that modulates transcription of gene sets via selective and non-covalent binding to a specific double-stranded genomic DNA sequence (sometimes referred to as a motif) within a cis-regulatory region. Regulatory regions include promoters (proximal and distal) and enhancers. Genes are transcriptional units, and include bacterial operons. ; multicellular organism development : The biological process whose specific outcome is the progression of a multicellular organism over time from an initial condition (e.g. a zygote or a young adult) to a later condition (e.g. a multicellular animal or an aged adult). ; DNA-binding transcription factor activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that modulates the transcription of specific gene sets transcribed by RNA polymerase II. ; cell differentiation : The process in which relatively unspecialized cells, e.g. embryonic or regenerative cells, acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. Differentiation includes the processes involved in commitment of a cell to a specific fate and its subsequent development to the mature state. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; nervous system development : The process whose specific outcome is the progression of nervous tissue over time, from its formation to its mature state. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; regulation of transcription by RNA polymerase II : Any process that modulates the frequency, rate or extent of transcription mediated by RNA polymerase II. ; RNA polymerase II cis-regulatory region sequence-specific DNA binding : Interacting selectively and non-covalently with a specific upstream regulatory DNA sequence (transcription factor recognition sequence or binding site) located in cis relative to the transcription start site (i.e., on the same strand of DNA) of a gene transcribed by RNA polymerase II. ; chromatin : The ordered and organized complex of DNA, protein, and sometimes RNA, that forms the chromosome. ; sequence-specific double-stranded DNA binding : Interacting selectively and non-covalently with double-stranded DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA, e.g. promotor binding or rDNA binding. ; DNA-binding transcription activator activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that activates or increases transcription of specific gene sets transcribed by RNA polymerase II. ; positive regulation of transcription by RNA polymerase II : Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter. ; RNA polymerase II transcription regulator complex : A transcription factor complex that acts at a regulatory region of a gene transcribed by RNA polymerase II. ; animal organ morphogenesis : Morphogenesis of an animal organ. An organ is defined as a tissue or set of tissues that work together to perform a specific function or functions. Morphogenesis is the process in which anatomical structures are generated and organized. Organs are commonly observed as visibly distinct structures, but may also exist as loosely associated clusters of cells that work together to perform a specific function or functions. ; RNA polymerase II transcription regulatory region sequence-specific DNA binding : Interacting selectively and non-covalently with a specific sequence of DNA that is part of a regulatory region that controls the transcription of a gene or cistron by RNA polymerase II. ; DNA-binding transcription activator activity : A DNA-binding transcription factor activity that activates or increases transcription of specific gene sets. ; nuclear receptor binding : Interacting selectively and non-covalently, in a ligand dependent manner, with a nuclear receptor protein. ; leucine zipper domain binding : Interacting selectively and non-covalently with a leucine zipper domain, a protein secondary structure exhibiting a periodic repetition of leucine residues at every seventh position over a distance covering eight helical turns. ; RNA polymerase II-specific DNA-binding transcription factor binding : Interacting selectively and non-covalently with a sequence-specific DNA binding RNA polymerase II transcription factor, any of the factors that interact selectively and non-covalently with a specific DNA sequence in order to modulate transcription. ;


Symbol
CRX
Name
cone-rod homeobox
Entrez ID
1406
Ensembl ID
ENSG00000105392    (more details)
KEGG ID
hsa:1406    (more details)
OMIM ID
120970
Uniprot ID
O43186  
GO ID
hsa:1406    (more details)
Chromosome
6
Strand
1
Start
42183284
End
42194956
miRNA Interactions
hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-4500 (RPM: 0.0022) / hsa-miR-455-3p (RPM: 82.7264) / hsa-miR-4451 (RPM: 0.0104) / hsa-miR-500a-5p (RPM: 1.3064) / hsa-miR-766-3p (RPM: 5.2956) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-4458 (RPM: 0.0998) / hsa-miR-4732-5p (RPM: 0.0008) / hsa-miR-3927-3p (RPM: 0.059) / hsa-miR-1247-3p (RPM: 20.5724) / hsa-miR-3178 (RPM: 0.0072) / hsa-miR-6831-5p (RPM: 0.0134) / hsa-miR-6516-5p (RPM: 0.859) / hsa-miR-6799-5p (RPM: 0.0034) / hsa-miR-6781-5p (RPM: 0.0224) / hsa-miR-6499-5p (RPM: 1.7916) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGATGGCGTATATGAACCCGGGGCCCCACTATTCTGTCAACGCCTTGGCCCTAAGTGGCCCCAGTGTGGATCTGATGCACCAGGCTGTGCCCTACCCAAGCGCCCCCAGGAAGCAGCGGCGGGAGCGCACCACCTTCACCCGGAGCCAACTGGAGGAGCTGGAGGCACTGTTTGCCAAGACCCAGTACCCAGACGTCTATGCCCGTGAGGAGGTGGCTCTGAAGATCAATCTGCCTGAGTCCAGGGTTCAGGTTTGGTTCAAGAACCGGAGGGCTAAATGCAGGCAGCAGCGACAGCAGCAGAAACAGCAGCAGCAGCCCCCAGGGGGCCAGGCCAAGGCCCGGCCTGCCAAGAGGAAGGCGGGCACGTCCCCAAGACCCTCCACAGATGTGTGTCCAGACCCTCTGGGCATCTCAGATTCCTACAGTCCCCCTCTGCCCGGCCCCTCAGGCTCCCCAACCACGGCAGTGGCCACTGTGTCCATCTGGAGCCCAGCCTCAGAGTCCCCTTTGCCTGAGGCGCAGCGGGCTGGGCTGGTGGCCTCAGGGCCGTCTCTGACCTCCGCCCCCTATGCCATGACCTACGCCCCGGCCTCCGCTTTCTGCTCTTCCCCCTCCGCCTATGGGTCTCCGAGCTCCTATTTCAGCGGCCTAGACCCCTACCTTTCTCCCATGGTGCCCCAGCTAGGGGGCCCGGCTCTTAGCCCCCTCTCTGGCCCCTCCGTGGGACCTTCCCTGGCCCAGTCCCCCACCTCCCTATCAGGCCAGAGCTATGGCGCCTACAGCCCCGTGGATAGCTTGGAATTCAAGGACCCCACGGGCACCTGGAAATTCACCTACAATCCCATGGACCCTCTGGACTACAAGGATCAGAGTGCCTGGAAGTTTCAGATCTTGTAG

Back to List