Details for gene: IDH3A


tricarboxylic acid cycle : A nearly universal metabolic pathway in which the acetyl group of acetyl coenzyme A is effectively oxidized to two CO2 and four pairs of electrons are transferred to coenzymes. The acetyl group combines with oxaloacetate to form citrate, which undergoes successive transformations to isocitrate, 2-oxoglutarate, succinyl-CoA, succinate, fumarate, malate, and oxaloacetate again, thus completing the cycle. In eukaryotes the tricarboxylic acid is confined to the mitochondria. See also glyoxylate cycle. ; oxidoreductase activity, acting on the CH-OH group of donors, NAD or NADP as acceptor : Catalysis of an oxidation-reduction (redox) reaction in which a CH-OH group acts as a hydrogen or electron donor and reduces NAD+ or NADP. ; magnesium ion binding : Interacting selectively and non-covalently with magnesium (Mg) ions. ; NAD binding : Interacting selectively and non-covalently with nicotinamide adenine dinucleotide, a coenzyme involved in many redox and biosynthetic reactions; binding may be to either the oxidized form, NAD+, or the reduced form, NADH. ; mitochondrion : A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration. ; isocitrate dehydrogenase (NAD+) activity : Catalysis of the reaction: isocitrate + NAD+ = 2-oxoglutarate + CO2 + NADH + H+. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; oxidoreductase activity : Catalysis of an oxidation-reduction (redox) reaction, a reversible chemical reaction in which the oxidation state of an atom or atoms within a molecule is altered. One substrate acts as a hydrogen or electron donor and becomes oxidized, while the other acts as hydrogen or electron acceptor and becomes reduced. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; mitochondrial matrix : The gel-like material, with considerable fine structure, that lies in the matrix space, or lumen, of a mitochondrion. It contains the enzymes of the tricarboxylic acid cycle and, in some organisms, the enzymes concerned with fatty acid oxidation. ; carbohydrate metabolic process : The chemical reactions and pathways involving carbohydrates, any of a group of organic compounds based of the general formula Cx(H2O)y. Includes the formation of carbohydrate derivatives by the addition of a carbohydrate residue to another molecule. ; isocitrate metabolic process : The chemical reactions and pathways involving isocitrate, the anion of isocitric acid, 1-hydroxy-1,2,3-propanetricarboxylic acid. Isocitrate is an important intermediate in the TCA cycle and the glycoxylate cycle. ;


Symbol
IDH3A
Name
isocitrate dehydrogenase (NAD(+)) 3 catalytic subunit alpha
Entrez ID
3419
Ensembl ID
ENSG00000166411    (more details)
KEGG ID
hsa:3419    (more details)
OMIM ID
601149
Uniprot ID
P50213  
GO ID
hsa:3419    (more details)
Chromosome
20
Strand
1
Start
2658395
End
2664219
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-922 (RPM: 0.0014) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-378a-5p (RPM: 22.027) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-153-3p (RPM: 53.4548) / hsa-miR-4784 (RPM: 0.0222) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-432-5p (RPM: 29.044) / hsa-miR-3150b-3p (RPM: 0.0582) / hsa-miR-4434 (RPM: 0.0012) / hsa-miR-4516 (RPM: 0.4114) / hsa-miR-20a-3p (RPM: 0.8156) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-29a-5p (RPM: 3.125) / hsa-miR-3125 (RPM: 1.2126) / hsa-miR-3916 (RPM: 0.1044) / hsa-miR-3154 (RPM: 0.1024) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-324-5p (RPM: 32.337) / hsa-miR-6760-5p (RPM: 0.0008) / hsa-miR-6770-5p (RPM: 0.0456) / hsa-miR-6847-5p (RPM: 0.6722) / hsa-miR-6859-5p (RPM: 0.856) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Metabolic pathways / Carbon metabolism / Citrate cycle (TCA cycle) / 2-Oxocarboxylic acid metabolism / Biosynthesis of antibiotics /
Sequence
ATGGCTGGGCCCGCGTGGATCTCTAAGGTCTCTCGGCTGCTGGGGGCATTCCACAACCCAAAACAGGTGACCAGAGGTTTTACTGGTGGTGTTCAGACAGTAACTTTAATTCCAGGAGATGGTATTGGCCCAGAAATTTCAGCTGCAGTTATGAAGATTTTTGATGCTGCCAAAGCACCTATTCAGTGGGAGGAGCGGAACGTCACTGCCATTCAAGGACCTGGAGGAAAGTGGATGATCCCTTCAGAGGCTAAAGAGTCCATGGATAAGAACAAGATGGGCTTGAAAGGCCCTTTGAAGACCCCAATAGCAGCCGGTCACCCATCTATGAATTTACTGCTGCGCAAAACATTTGACCTTTACGCGAATGTCCGACCATGTGTCTCTATCGAAGGCTATAAAACCCCTTACACCGATGTAAATATTGTGACCATTCGAGAGAACACAGAAGGAGAATACAGTGGAATTGAGCATGTGATTGTTGATGGAGTCGTGCAGAGTATCAAGCTCATCACCGAGGGGGCGAGCAAGCGCATTGCTGAGTTTGCCTTTGAGTATGCCCGGAACAACCACCGGAGCAACGTCACGGCGGTGCACAAAGCCAACATCATGCGGATGTCAGATGGGCTTTTTCTACAAAAATGCAGGGAAGTTGCAGAAAGCTGTAAAGATATTAAATTTAATGAGATGTACCTTGATACAGTATGTTTGAATATGGTACAAGATCCTTCCCAATTTGATGTTCTTGTTATGCCAAATTTGTATGGAGACATCCTTAGTGACTTGTGTGCAGGATTGATCGGAGGTCTCGGTGTGACACCAAGTGGCAACATTGGAGCCAATGGGGTTGCAATTTTTGAGTCGGTTCATGGGACGGCTCCAGACATTGCAGGCAAGGACATGGCGAATCCCACAGCCCTCCTGCTCAGTGCCGTGATGATGCTGCGCCACATGGGACTTTTTGACCATGCTGCAAGAATTGAGGCTGCGTGTTTTGCTACAATTAAGGACGGAAAGAGCTTGACAAAAGATTTGGGAGGCAATGCAAAATGCTCAGACTTCACAGAGGAAATCTGTCGCCGAGTAAAAGATTTAGATTAA

Back to List