Details for gene: IMPDH1


catalytic activity : Catalysis of a biochemical reaction at physiological temperatures. In biologically catalyzed reactions, the reactants are known as substrates, and the catalysts are naturally occurring macromolecular substances known as enzymes. Enzymes possess specific binding sites for substrates, and are usually composed wholly or largely of protein, but RNA that has catalytic activity (ribozyme) is often also regarded as enzymatic. ; purine nucleotide biosynthetic process : The chemical reactions and pathways resulting in the formation of a purine nucleotide, a compound consisting of nucleoside (a purine base linked to a deoxyribose or ribose sugar) esterified with a phosphate group at either the 3' or 5'-hydroxyl group of the sugar. ; IMP dehydrogenase activity : Catalysis of the reaction: inosine 5'-phosphate + NAD+ + H2O = xanthosine 5'-phosphate + NADH + H+. ; oxidoreductase activity : Catalysis of an oxidation-reduction (redox) reaction, a reversible chemical reaction in which the oxidation state of an atom or atoms within a molecule is altered. One substrate acts as a hydrogen or electron donor and becomes oxidized, while the other acts as hydrogen or electron acceptor and becomes reduced. ; RNA binding : Interacting selectively and non-covalently with an RNA molecule or a portion thereof. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; nucleotide binding : Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; DNA binding : Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid). ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; nucleic acid binding : Interacting selectively and non-covalently with any nucleic acid. ; GMP biosynthetic process : The chemical reactions and pathways resulting in the formation of GMP, guanosine monophosphate. ; secretory granule lumen : The volume enclosed by the membrane of a secretory granule. ; ficolin-1-rich granule lumen : Any membrane-enclosed lumen that is part of a ficolin-1-rich granule. ; azurophil granule lumen : The volume enclosed by the membrane of an azurophil granule, a primary lysosomal granule found in neutrophil granulocytes that contains a wide range of hydrolytic enzymes and is released into the extracellular fluid. ; GTP biosynthetic process : The chemical reactions and pathways resulting in the formation of GTP, guanosine triphosphate. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ;


Symbol
IMPDH1
Name
inosine monophosphate dehydrogenase 1
Entrez ID
3614
Ensembl ID
ENSG00000106348    (more details)
KEGG ID
hsa:3614    (more details)
OMIM ID
146690
Uniprot ID
B3KRZ3  
GO ID
hsa:3614    (more details)
Chromosome
6
Strand
-1
Start
10762723
End
10838553
miRNA Interactions
hsa-miR-29b-3p (RPM: 118.8178) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-29a-3p (RPM: 1246.9046) / hsa-miR-423-5p (RPM: 976.289) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-205-5p (RPM: 5027.3352) / hsa-miR-454-3p (RPM: 66.0634) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-19a-3p (RPM: 25.4064) / hsa-miR-103a-2-5p (RPM: 0.387) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-1301-3p (RPM: 47.2112) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-miR-128-3p (RPM: 329.321) / hsa-let-7f-1-3p (RPM: 9.5776) / hsa-let-7a-3p (RPM: 33.7298) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-1260a (RPM: 220.2948) / hsa-miR-25-3p (RPM: 1063.0626) / hsa-miR-140-3p (RPM: 779.3088) / hsa-miR-615-3p (RPM: 0.1424) / hsa-miR-708-5p (RPM: 69.2328) / hsa-miR-31-3p (RPM: 2.995) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-28-5p (RPM: 190.0872) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-370-3p (RPM: 8.8808) / hsa-miR-1260b (RPM: 243.165) / hsa-miR-100-5p (RPM: 3365.0918) / hsa-miR-99a-5p (RPM: 1181.6944) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-99b-5p (RPM: 14318.7458) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Metabolic pathways / Purine metabolism / Drug metabolism - other enzymes /
Sequence
ATGGCGGACTACCTGATCAGCGGCGGCACCGGCTACGTGCCCGAGGATGGGCTCACCGCGCAGCAGCTCTTCGCCAGCGCCGACGGCCTCACCTACAACGACTTCCTGATTCTCCCAGGATTCATAGACTTCATAGCTGATGAGGTGGACCTGACCTCAGCCCTGACCCGGAAGATCACGCTGAAGACGCCACTGATCTCCTCCCCCATGGACACTGTGACAGAGGCTGACATGGCCATTGCCATGGCTCTGATGGGAGGTATTGGTTTCATTCACCACAACTGCACCCCAGAGTTCCAGGCCAACGAGGTGCGGAAGGTCAAGAAGTTTGAACAGGGCTTCATCACGGACCCTGTGGTGCTGAGCCCCTCGCACACTGTGGGCGATGTGCTGGAGGCCAAGATGCGGCATGGCTTCTCTGGCATCCCCATCACTGAGACGGGCACCATGGGCAGCAAGCTGGTGGGCATCGTCACCTCCCGAGACATCGACTTTCTTGCTGAGAAGGACCACACCACCCTCCTCAGTGAGGTGATGACGCCAAGGATTGAACTGGTGGTGGCTCCAGCAGGTGTGACGTTGAAAGAGGCAAATGAGATCCTGCAGCGTAGCAAGAAAGGGAAGCTGCCTATCGTCAATGATTGCGATGAGCTGGTGGCCATCATCGCCCGCACCGACCTGAAGAAGAACCGAGACTACCCTCTGGCCTCCAAGGATTCCCAGAAGCAGCTGCTCTGTGGGGCAGCTGTGGGCACCCGTGAGGATGACAAATACCGTCTGGACCTGCTCACCCAGGCGGGCGTCGACGTCATAGTCTTGGACTCGTCCCAAGGGAATTCGGTGTATCAGATCGCCATGGTGCATTACATCAAACAGAAGTACCCCCACCTCCAGGTGATTGGGGGGAACGTGGTGACAGCAGCCCAGGCCAAGAACCTGATTGATGCTGGTGTGGACGGGCTGCGCGTGGGCATGGGCTGCGGCTCCATCTGCATCACCCAGGAAGTGATGGCCTGTGGTCGGCCCCAGGGCACTGCTGTGTACAAGGTGGCTGAGTATGCCCGGCGCTTTGGTGTGCCCATCATAGCCGATGGCGGCATCCAGACCGTGGGACACGTGGTCAAGGCCCTGGCCCTTGGAGCCTCCACAGTGATGATGGGCTCCCTGCTGGCCGCCACTACGGAGGCCCCTGGCGAGTACTTCTTCTCAGACGGGGTGCGGCTCAAGAAGTACCGGGGCATGGGCTCACTGGATGCCATGGAGAAGAGCAGCAGCAGCCAGAAACGATACTTCAGCGAGGGGGATAAAGTGAAGATCGCGCAGGGTGTCTCGGGCTCCATCCAGGACAAAGGATCCATTCAGAAGTTCGTGCCCTACCTCATAGCAGGCATCCAACACGGCTGCCAGGATATCGGGGCCCGCAGCCTGTCTGTCCTTCGGTCCATGATGTACTCAGGAGAGCTCAAGTTTGAGAAGCGGACCATGTCGGCCCAGATTGAGGGTGGTGTCCATGGCCTGCACTCTTACGAAAAGCGGCTGTACTGA

Back to List