Details for gene: MAK


ATP binding : Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator. ; protein phosphorylation : The process of introducing a phosphate group on to a protein. ; protein kinase activity : Catalysis of the phosphorylation of an amino acid residue in a protein, usually according to the reaction: a protein + ATP = a phosphoprotein + ADP. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; nucleotide binding : Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose. ; protein serine/threonine kinase activity : Catalysis of the reactions: ATP + protein serine = ADP + protein serine phosphate, and ATP + protein threonine = ADP + protein threonine phosphate. ; kinase activity : Catalysis of the transfer of a phosphate group, usually from ATP, to a substrate molecule. ; transferase activity : Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2. ; protein serine kinase activity : Catalysis of the reactions: ATP + protein serine = ADP + protein serine phosphate. ; protein threonine kinase activity : Catalysis of the reactions: ATP + protein threonine = ADP + threonine phosphate. ; phosphorylation : The process of introducing a phosphate group into a molecule, usually with the formation of a phosphoric ester, a phosphoric anhydride or a phosphoric amide. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; positive regulation of transcription, DNA-templated : Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription. ; cell differentiation : The process in which relatively unspecialized cells, e.g. embryonic or regenerative cells, acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. Differentiation includes the processes involved in commitment of a cell to a specific fate and its subsequent development to the mature state. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; microtubule organizing center : An intracellular structure that can catalyze gamma-tubulin-dependent microtubule nucleation and that can anchor microtubules by interacting with their minus ends, plus ends or sides. ; spindle : The array of microtubules and associated molecules that forms between opposite poles of a eukaryotic cell during mitosis or meiosis and serves to move the duplicated chromosomes apart. ; midbody : A thin cytoplasmic bridge formed between daughter cells at the end of cytokinesis. The midbody forms where the contractile ring constricts, and may persist for some time before finally breaking to complete cytokinesis. ; transcription coactivator activity : A transcription coregulator activity that activates or increases the transcription of specific gene sets via binding to a DNA-bound DNA-binding transcription factor, either on its own or as part of a complex. Coactivators often act by altering chromatin structure and modifications. For example, one class of transcription coactivators modifies chromatin structure through covalent modification of histones. A second class remodels the conformation of chromatin in an ATP-dependent fashion. A third class modulates interactions of DNA-bound DNA-binding transcription factors with other transcription coregulators. A fourth class of coactivator activity is the bridging of a DNA-binding transcription factor to the general (basal) transcription machinery. The Mediator complex, which bridges sequence-specific DNA binding transcription factors and RNA polymerase, is also a transcription coactivator. ; spermatogenesis : The developmental process by which male germ line stem cells self renew or give rise to successive cell types resulting in the development of a spermatozoa. ; centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ; protein autophosphorylation : The phosphorylation by a protein of one or more of its own amino acid residues (cis-autophosphorylation), or residues on an identical protein (trans-autophosphorylation). ; photoreceptor inner segment : The inner segment of a vertebrate photoreceptor containing mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ; intracellular signal transduction : The process in which a signal is passed on to downstream components within the cell, which become activated themselves to further propagate the signal and finally trigger a change in the function or state of the cell. ; cilium assembly : The assembly of a cilium, a specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface. Each cilium is bounded by an extrusion of the cytoplasmic membrane, and contains a regular longitudinal array of microtubules, anchored basally in a centriole. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; mitotic spindle : A spindle that forms as part of mitosis. Mitotic and meiotic spindles contain distinctive complements of proteins associated with microtubules. ; photoreceptor cell maintenance : Any process preventing the degeneration of the photoreceptor, a specialized cell type that is sensitive to light. ; intraciliary transport : The bidirectional movement of large protein complexes along microtubules within a cilium, mediated by motor proteins. ; negative regulation of non-motile cilium assembly : Any process that stops, prevents or reduces the frequency, rate or extent of non-motile cilium assembly. ; axoneme : The bundle of microtubules and associated proteins that forms the core of cilia (also called flagella) in eukaryotic cells and is responsible for their movements. ; motile cilium : A cilium which may have a variable arrangement of axonemal microtubules and also contains molecular motors. It may beat with a whip-like pattern that promotes cell motility or transport of fluids and other cells across a cell surface, such as on epithelial cells that line the lumenal ducts of various tissues; or they may display a distinct twirling motion that directs fluid flow asymmetrically across the cellular surface to affect asymmetric body plan organization. Motile cilia can be found in single as well as multiple copies per cell. ; photoreceptor connecting cilium : The portion of the photoreceptor cell cilium linking the photoreceptor inner and outer segments. It's considered to be equivalent to the ciliary transition zone. ;


Symbol
MAK
Name
male germ cell associated kinase
Entrez ID
4117
Ensembl ID
ENSG00000111837    (more details)
KEGG ID
hsa:4117    (more details)
OMIM ID
154235
Uniprot ID
P20794  
GO ID
hsa:4117    (more details)
Chromosome
19
Strand
-1
Start
44846175
End
44889223
miRNA Interactions
hsa-miR-338-3p (RPM: 158.4942) / hsa-miR-450b-5p (RPM: 4.6184) / hsa-miR-495-3p (RPM: 8.062) / hsa-miR-5688 (RPM: 0.6258) / hsa-miR-4649-3p (RPM: 0.0112) / hsa-miR-1827 (RPM: 0.03) / hsa-miR-4722-5p (RPM: 0.0332) / hsa-miR-940 (RPM: 4.614) / hsa-miR-3929 (RPM: 0.0406) / hsa-miR-485-5p (RPM: 12.0734) / hsa-miR-4768-3p (RPM: 0.002) / hsa-miR-665 (RPM: 0.445) / hsa-miR-34b-3p (RPM: 5.6562) / hsa-miR-3614-5p (RPM: 0.263) / hsa-miR-4478 (RPM: 0.0594) / hsa-miR-377-5p (RPM: 8.4706) / hsa-miR-6880-5p (RPM: 0.1286) / hsa-miR-6851-5p (RPM: 0.0318) / hsa-miR-7847-3p (RPM: 0.0118) / hsa-miR-6808-5p (RPM: 0.0032) / hsa-miR-6884-5p (RPM: 0.168) / hsa-miR-6840-3p (RPM: 0.0218) / hsa-miR-6893-5p (RPM: 0.0066) / hsa-miR-6746-5p (RPM: 0.032) / hsa-miR-6771-5p (RPM: 0.0032) / hsa-miR-6500-3p (RPM: 1.2556) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGAACCGATACACAACCATGAGACAGTTGGGGGACGGCACGTATGGGAGTGTGCTTATGGGCAAGAGTAATGAATCCGGGGAGCTGGTGGCCATCAAAAGGATGAAGAGAAAGTTCTATTCTTGGGATGAATGCATGAACTTGAGAGAAGTTAAGTCTCTGAAGAAACTTAATCATGCCAATGTTATTAAATTGAAAGAAGTTATCAGAGAAAATGACCATCTTTATTTTATATTTGAATATATGAAAGAAAACCTCTATCAATTAATGAAAGACAGAAACAAGTTGTTCCCTGAATCAGTCATCAGAAATATTATGTATCAAATATTGCAAGGGCTGGCTTTTATCCATAAACATGGCTTTTTTCATAGGGACATGAAACCAGAAAACTTGCTTTGTATGGGTCCAGAGCTTGTGAAAATTGCTGATTTTGGACTTGCAAGAGAATTAAGGTCACAGCCACCATACACTGATTATGTATCTACCAGATGGTATCGTGCCCCTGAAGTTTTACTGAGATCTTCAGTTTATAGTTCTCCCATTGATGTGTGGGCTGTTGGAAGTATCATGGCTGAACTCTATATGTTAAGGCCACTTTTCCCAGGGACAAGTGAGGTCGATGAAATCTTTAAAATTTGCCAAGTTTTAGGGACTCCCAAAAAAAGTGACTGGCCAGAAGGATACCAGCTGGCATCCTCTATGAACTTCCGTTTTCCCCAGTGTGTTCCTATAAACTTAAAAACTCTTATTCCCAATGCCAGTAATGAAGCTATTCAGCTCATGACCGAAATGTTGAATTGGGATCCAAAGAAACGACCGACAGCAAGCCAGGCATTGAAACACCCATATTTTCAAGTTGGTCAGGTATTAGGCCCTTCGTCAAATCATCTGGAATCAAAACAGTCTTTAAATAAGCAGCTGCAACCATTAGAATCAAAGCCATCTTTAGTTGAGGTAGAGCCTAAGCCTCTGCCGGATATAATCGATCAGGTTGTTGGACAACCCCAGCCAAAAACTAGCCAGCAGCCACTGCAGCCCATTCAGCCGCCACAGAACCTGAGCGTCCAGCAACCTCCAAAGCAACAGAGTCAGGAGAAACCGCCACAAACGCTATTCCCGAGCATCGTCAAAAACATGCCAACTAAGCCAAATGGCACACTGAGTCATAAAAGTGGTAGGAGGCGTTGGGGTCAGACTATCTTCAAGTCTGGAGATAGCTGGGAAGAGTTGGAGGACTATGATTTCGGAGCCTCCCATTCCAAGAAGCCAAGCATGGGTGTTTTTAAAGAAAAAAGGAAAAAAGATTCTCCATTTCGGCTTCCAGAGCCAGTACCCTCAGGCTCCAACCACTCGACAGGGGAAAACAAGAGCTTACCTGCTGTTACTTCCCTAAAATCTGATTCCGAATTGTCAACTGCTCCAACCTCTAAACAGTACTACTTGAAACAATCAAGATATCTTCCAGGTGTGAATCCCAAGAAGGTGTCCTTGATAGCCAGTGGAAAGGAAATAAACCCCCACACTTGGAGCAACCAGTTATTCCCCAAGTCACTGGGACCCGTTGGGGCAGAACTTGCTTTCAAAAGGAGCAATGCAGGAAATCTTGGAAGTTATGCTACTTACAATCAGTCAGGATATATTCCTTCCTTTCTCAAAAAAGAAGTGCAGTCAGCTGGCCAGAGGATCCACTTAGCACCTCTCAATGCAACGGCTTCAGAATATACCTGGAACACAAAAACTGGTCGGGGGCAGTTTTCAGGACGTACTTATAATCCTACAGCAAAAAACCTAAATATTGTGAACCGTGCACAGCCCATTCCCTCAGTGCATGGGAGGACAGACTGGGTGGCCAAGTATGGAGGCCACCGGTAG

Back to List