Details for gene: NEK2


ATP binding : Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator. ; protein phosphorylation : The process of introducing a phosphate group on to a protein. ; protein kinase activity : Catalysis of the phosphorylation of an amino acid residue in a protein, usually according to the reaction: a protein + ATP = a phosphoprotein + ADP. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; protein-containing complex : A stable assembly of two or more macromolecules, i.e. proteins, nucleic acids, carbohydrates or lipids, in which at least one component is a protein and the constituent parts function together. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; nucleotide binding : Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose. ; protein serine/threonine kinase activity : Catalysis of the reactions: ATP + protein serine = ADP + protein serine phosphate, and ATP + protein threonine = ADP + protein threonine phosphate. ; kinase activity : Catalysis of the transfer of a phosphate group, usually from ATP, to a substrate molecule. ; transferase activity : Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2. ; protein serine kinase activity : Catalysis of the reactions: ATP + protein serine = ADP + protein serine phosphate. ; protein threonine kinase activity : Catalysis of the reactions: ATP + protein threonine = ADP + threonine phosphate. ; phosphorylation : The process of introducing a phosphate group into a molecule, usually with the formation of a phosphoric ester, a phosphoric anhydride or a phosphoric amide. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; cell division : The process resulting in division and partitioning of components of a cell to form more cells; may or may not be accompanied by the physical separation of a cell into distinct, individually membrane-bounded daughter cells. ; chromosome : A structure composed of a very long molecule of DNA and associated proteins (e.g. histones) that carries hereditary information. ; centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ; nucleolus : A small, dense body one or more of which are present in the nucleus of eukaryotic cells. It is rich in RNA and protein, is not bounded by a limiting membrane, and is not seen during mitosis. Its prime function is the transcription of the nucleolar DNA into 45S ribosomal-precursor RNA, the processing of this RNA into 5.8S, 18S, and 28S components of ribosomal RNA, and the association of these components with 5S RNA and proteins synthesized outside the nucleolus. This association results in the formation of ribonucleoprotein precursors; these pass into the cytoplasm and mature into the 40S and 60S subunits of the ribosome. ; microtubule : Any of the long, generally straight, hollow tubes of internal diameter 12-15 nm and external diameter 24 nm found in a wide variety of eukaryotic cells; each consists (usually) of 13 protofilaments of polymeric tubulin, staggered in such a manner that the tubulin monomers are arranged in a helical pattern on the microtubular surface, and with the alpha/beta axes of the tubulin subunits parallel to the long axis of the tubule; exist in equilibrium with pool of tubulin monomers and can be rapidly assembled or disassembled in response to physiological stimuli; concerned with force generation, e.g. in the spindle. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; cell cycle : The progression of biochemical and morphological phases and events that occur in a cell during successive cell replication or nuclear replication events. Canonically, the cell cycle comprises the replication and segregation of genetic material followed by the division of the cell, but in endocycles or syncytial cells nuclear replication or nuclear division may not be followed by cell division. ; chromosome, centromeric region : The region of a chromosome that includes the centromeric DNA and associated proteins. In monocentric chromosomes, this region corresponds to a single area of the chromosome, whereas in holocentric chromosomes, it is evenly distributed along the chromosome. ; meiotic cell cycle : Progression through the phases of the meiotic cell cycle, in which canonically a cell replicates to produce four offspring with half the chromosomal content of the progenitor cell via two nuclear divisions. ; microtubule organizing center : An intracellular structure that can catalyze gamma-tubulin-dependent microtubule nucleation and that can anchor microtubules by interacting with their minus ends, plus ends or sides. ; chromosome segregation : The process in which genetic material, in the form of chromosomes, is organized into specific structures and then physically separated and apportioned to two or more sets. In eukaryotes, chromosome segregation begins with the condensation of chromosomes, includes chromosome separation, and ends when chromosomes have completed movement to the spindle poles. ; kinetochore : A multisubunit complex that is located at the centromeric region of DNA and provides an attachment point for the spindle microtubules. ; spindle pole : Either of the ends of a spindle, where spindle microtubules are organized; usually contains a microtubule organizing center and accessory molecules, spindle microtubules and astral microtubules. ; protein autophosphorylation : The phosphorylation by a protein of one or more of its own amino acid residues (cis-autophosphorylation), or residues on an identical protein (trans-autophosphorylation). ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; protein phosphatase binding : Interacting selectively and non-covalently with any protein phosphatase. ; positive regulation of telomere maintenance via telomerase : Any process that activates or increases the frequency, rate or extent of the addition of telomeric repeats by telomerase. ; positive regulation of telomerase activity : Any process that activates or increases the frequency, rate or extent of telomerase activity, the catalysis of the reaction: deoxynucleoside triphosphate + DNA(n) = diphosphate + DNA(n+1). ; positive regulation of telomere capping : Any process that activates or increases the frequency, rate or extent of telomere capping. ; regulation of mitotic nuclear division : Any process that modulates the frequency, rate or extent of mitosis. ; regulation of mitotic centrosome separation : Any process that modulates the frequency, rate or extent of the separation of duplicated centrosome components at the beginning of mitosis. ; mitotic cell cycle : Progression through the phases of the mitotic cell cycle, the most common eukaryotic cell cycle, which canonically comprises four successive phases called G1, S, G2, and M and includes replication of the genome and the subsequent segregation of chromosomes into daughter cells. In some variant cell cycles nuclear replication or nuclear division may not be followed by cell division, or G1 and G2 phases may be absent. ; spindle assembly : The aggregation, arrangement and bonding together of a set of components to form the spindle, the array of microtubules and associated molecules that serves to move duplicated chromosomes apart. ; regulation of attachment of spindle microtubules to kinetochore : Any process that modulates the frequency, rate or extent of the attachment of spindle microtubules to the kinetochore. ; mitotic sister chromatid segregation : The cell cycle process in which replicated homologous chromosomes are organized and then physically separated and apportioned to two sets during the mitotic cell cycle. Each replicated chromosome, composed of two sister chromatids, aligns at the cell equator, paired with its homologous partner. One homolog of each morphologic type goes into each of the resulting chromosome sets. ; blastocyst development : The process whose specific outcome is the progression of the blastocyst over time, from its formation to the mature structure. The mammalian blastocyst is a hollow ball of cells containing two cell types, the inner cell mass and the trophectoderm. ; negative regulation of DNA binding : Any process that stops or reduces the frequency, rate or extent of DNA binding. DNA binding is any process in which a gene product interacts selectively with DNA (deoxyribonucleic acid). ; centrosome separation : The process in which duplicated centrosome components move away from each other. The centriole pair within each centrosome becomes part of a separate microtubule organizing center that nucleates a radial array of microtubules called an aster. The two asters move to opposite sides of the nucleus to form the two poles of the mitotic spindle. ; mitotic spindle assembly : Mitotic bipolar spindle assembly begins with spindle microtubule nucleation from the separated spindle pole body, includes spindle elongation during prometaphase, and is complete when all kinetochores are stably attached the spindle, and the spindle assembly checkpoint is satisfied. ; negative regulation of centriole-centriole cohesion : Any process that stops, prevents or reduces the frequency, rate or extent of centriole-centriole cohesion. ; condensed nuclear chromosome : A highly compacted molecule of DNA and associated proteins resulting in a cytologically distinct nuclear chromosome. ; midbody : A thin cytoplasmic bridge formed between daughter cells at the end of cytokinesis. The midbody forms where the contractile ring constricts, and may persist for some time before finally breaking to complete cytokinesis. ; : ;


Symbol
NEK2
Name
NIMA related kinase 2
Entrez ID
4751
Ensembl ID
ENSG00000117650    (more details)
KEGG ID
hsa:4751    (more details)
OMIM ID
604043
Uniprot ID
F6U4U2  
GO ID
hsa:4751    (more details)
Chromosome
1
Strand
-1
Start
211658657
End
211675630
miRNA Interactions
hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-126-5p (RPM: 3089.0568) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-876-5p (RPM: 0.4744) / hsa-miR-4778-5p (RPM: 0.0716) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-376a-5p (RPM: 4.9822) / hsa-miR-4668-5p (RPM: 0.092) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-126-3p (RPM: 494.5936) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-210-3p (RPM: 361.0562) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Regulation of PLK1 Activity at G2/M Transition / Loss of Nlp from mitotic centrosomes / Recruitment of mitotic centrosome proteins and complexes / Anchoring of the basal body to the plasma membrane / APC-Cdc20 mediated degradation of Nek2A /
Sequence
ATGCCTTCCCGGGCTGAGGACTATGAAGTGTTGTACACCATTGGCACAGGCTCCTACGGCCGCTGCCAGAAGATCCGGAGGAAGAGTGATGGCAAGATATTAGTTTGGAAAGAACTTGACTATGGCTCCATGACAGAAGCTGAGAAACAGATGCTTGTTTCTGAAGTGAATTTGCTTCGTGAACTGAAACATCCAAACATCGTTCGTTACTATGATCGGATTATTGACCGGACCAATACAACACTGTACATTGTAATGGAATATTGTGAAGGAGGGGATCTGGCTAGTGTAATTACAAAGGGAACCAAGGAAAGGCAATACTTAGATGAAGAGTTTGTTCTTCGAGTGATGACTCAGTTGACTCTGGCCCTGAAGGAATGCCACAGACGAAGTGATGGTGGTCATACCGTATTGCATCGGGATCTGAAACCAGCCAATGTTTTCCTGGATGGCAAGCAAAACGTCAAGCTTGGAGACTTTGGGCTAGCTAGAATATTAAACCATGACACGAGTTTTGCAAAAACATTTGTTGGCACACCTTATTACATGTCTCCTGAACAAATGAATCGCATGTCCTACAATGAGAAATCAGATATCTGGTCATTGGGCTGCTTGCTGTATGAGTTATGTGCATTAATGCCTCCATTTACAGCTTTTAGCCAGAAAGAACTCGCTGGGAAAATCAGAGAAGGCAAATTCAGGCGAATTCCATACCGTTACTCTGATGAATTGAATGAAATTATTACGAGGATGTTAAACTTAAAGGATTACCATCGACCTTCTGTTGAAGAAATTCTTGAGAACCCTTTAATAGCAGATTTGGTTGCAGACGAGCAAAGAAGAAATCTTGAGAGAAGAGGGCGACAATTAGGAGAGCCAGAAAAATCGCAGGATTCCAGCCCTGTATTGAGTGAGCTGAAACTGAAGGAAATTCAGTTACAGGAGCGAGAGCGAGCTCTCAAAGCAAGAGAAGAAAGATTGGAGCAGAAAGAACAGGAGCTTTGTGTTCGTGAGAGACTAGCAGAGGACAAACTGGCTAGAGCAGAAAATCTGTTGAAGAACTACAGCTTGCTAAAGGAACGGAAGTTCCTGTCTCTGGCAAGTAATCCAGAACTTCTTAATCTTCCATCCTCAGTAATTAAGAAGAAAGTTCATTTCAGTGGGGAAAGTAAAGAGAACATCATGAGGAGTGAGAATTCTGAGAGTCAGCTCACATCTAAGTCCAAGTGCAAGGACCTGAAGAAAAGGCTTCACGCTGCCCAGCTGCGGGCTCAAGCCCTGTCAGATATTGAGAAAAATTACCAACTGAAAAGCAGACAGATCCTGGGCATGCGCTAG

Back to List