Details for gene: PDE6A


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; signal transduction : The cellular process in which a signal is conveyed to trigger a change in the activity or state of a cell. Signal transduction begins with reception of a signal (e.g. a ligand binding to a receptor or receptor activation by a stimulus such as light), or for signal transduction in the absence of ligand, signal-withdrawal or the activity of a constitutively active receptor. Signal transduction ends with regulation of a downstream cellular process, e.g. regulation of transcription or regulation of a metabolic process. Signal transduction covers signaling from receptors located on the surface of the cell and signaling via molecules located within the cell. For signaling between cells, signal transduction is restricted to events at and within the receiving cell. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; 3',5'-cyclic-nucleotide phosphodiesterase activity : Catalysis of the reaction: nucleoside 3',5'-cyclic phosphate + H2O = nucleoside 5'-phosphate. ; phosphoric diester hydrolase activity : Catalysis of the hydrolysis of a phosphodiester to give a phosphomonoester and a free hydroxyl group. ; 3',5'-cyclic-GMP phosphodiesterase activity : Catalysis of the reaction: guanosine 3',5'-cyclic phosphate + H2O = guanosine 5'-phosphate. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; hydrolase activity : Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3. ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; retina development in camera-type eye : The process whose specific outcome is the progression of the retina over time, from its formation to the mature structure. The retina is the innermost layer or coating at the back of the eyeball, which is sensitive to light and in which the optic nerve terminates. ; photoreceptor disc membrane : Stack of disc membranes located inside a photoreceptor outer segment, and containing densely packed molecules of photoreceptor proteins that traverse the lipid bilayer. Disc membranes arise as evaginations of the ciliary membrane during the development of the outer segment and may or may not remain contiguous with the ciliary membrane. ; photoreceptor outer segment membrane : The membrane surrounding the outer segment of a vertebrate photoreceptor. ;


Symbol
PDE6A
Name
phosphodiesterase 6A
Entrez ID
5145
Ensembl ID
ENSG00000132915    (more details)
KEGG ID
hsa:5145    (more details)
OMIM ID
180071
Uniprot ID
P16499  
GO ID
hsa:5145    (more details)
Chromosome
5
Strand
-1
Start
149857953
End
149944793
miRNA Interactions
hsa-miR-147a (RPM: 0.0014) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-378a-5p (RPM: 22.027) / hsa-miR-150-5p (RPM: 64.1654) / hsa-miR-1304-3p (RPM: 12.7066) / hsa-miR-214-5p (RPM: 5.1378) / hsa-miR-203b-3p (RPM: 3.2494) / hsa-miR-4635 (RPM: 0.0156) / hsa-miR-764 (RPM: 0.0112) / hsa-miR-4695-3p (RPM: 0.0182) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-5587-5p (RPM: 0.1104) / hsa-miR-3934-5p (RPM: 0.4022) / hsa-miR-212-5p (RPM: 3.5846) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-4680-5p (RPM: 0.061) / hsa-miR-1224-3p (RPM: 0.0484) / hsa-miR-125a-3p (RPM: 24.5112) / hsa-miR-4757-5p (RPM: 0.1232) / hsa-miR-3663-5p (RPM: 0.0058) / hsa-miR-186-3p (RPM: 0.0884) / hsa-miR-6778-3p (RPM: 0.0066) / hsa-miR-6131 (RPM: 0.0044) / hsa-miR-6787-3p (RPM: 0.1544) / hsa-miR-6890-3p (RPM: 0.0048) / hsa-miR-6736-3p (RPM: 0.0064) / hsa-miR-6821-3p (RPM: 0.0074) / hsa-miR-6514-3p (RPM: 0.0114) / hsa-miR-6790-3p (RPM: 0.0104) / hsa-miR-7158-3p (RPM: 1.0142) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Purine metabolism / Phototransduction /
Sequence
ATGGGCGAGGTGACAGCAGAGGAGGTGGAGAAGTTCCTGGACTCGAATATTGGCTTTGCCAAACAGTACTACAACCTCCACTACCGGGCCAAGCTCATCTCCGACCTCCTTGGGGCCAAGGAGGCTGCCGTGGACTTCAGCAACTACCACTCCCCGAGCAGCATGGAGGAGAGCGAAATCATCTTTGATCTCCTGCGGGACTTTCAGGAGAATTTACAGACAGAGAAATGCATCTTCAATGTCATGAAGAAGCTGTGCTTCCTCCTGCAGGCAGACCGCATGAGCCTGTTCATGTACCGGACCCGCAATGGCATCGCAGAGCTGGCCACCAGGCTTTTCAATGTCCACAAGGATGCTGTCCTCGAGGACTGCCTGGTGATGCCCGACCAAGAGATCGTCTTCCCTTTGGACATGGGCATCGTGGGCCATGTCGCACACTCTAAGAAGATTGCTAACGTCCCCAACACAGAGGAGGATGAGCATTTCTGTGACTTTGTGGACATCCTCACAGAGTACAAGACCAAGAACATCTTGGCTTCCCCCATAATGAATGGGAAGGATGTGGTGGCCATAATCATGGCTGTGAATAAAGTGGATGGATCCCACTTCACCAAGAGAGATGAAGAGATTCTTCTCAAGTACCTCAATTTTGCAAATCTAATCATGAAGGTGTACCACCTGAGTTACCTGCACAACTGTGAAACTCGACGTGGCCAGATACTGCTGTGGTCTGGGAGCAAAGTCTTTGAAGAACTTACGGACATCGAACGACAGTTCCACAAAGCCCTGTACACAGTCCGTGCTTTCCTCAACTGTGACAGATACTCTGTGGGTCTCTTAGACATGACCAAGCAGAAGGAATTTTTTGATGTGTGGCCGGTTCTGATGGGTGAAGTTCCACCTTACTCTGGTCCCAGGACTCCGGATGGAAGAGAAATTAACTTTTACAAGGTCATTGACTACATCCTGCATGGCAAAGAGGACATCAAAGTCATCCCGAATCCACCTCCTGACCATTGGGCTTTAGTAAGCGGTCTCCCAGCTTATGTTGCCCAGAATGGCCTGATTTGCAACATCATGAATGCGCCTGCGGAGGACTTTTTTGCATTTCAGAAAGAACCTCTGGATGAGTCTGGATGGATGATTAAAAATGTGCTTTCAATGCCGATTGTGAACAAGAAGGAAGAAATTGTTGGAGTGGCCACATTTTACAATCGTAAAGATGGGAAGCCCTTTGATGAAATGGATGAGACGCTCATGGAGTCTTTGACTCAATTTCTGGGCTGGTCTGTCTTAAATCCTGACACCTATGAGTCAATGAATAAACTTGAAAATAGGAAGGATATTTTCCAGGACATAGTAAAATATCATGTGAAGTGTGACAATGAAGAAATTCAGAAAATCTTGAAAACCAGAGAGGTGTATGGGAAGGAGCCATGGGAGTGTGAGGAAGAGGAGCTGGCTGAGATCCTGCAAGCGGAGCTGCCAGATGCAGATAAATACGAAATTAATAAATTTCACTTCAGTGACTTACCCCTAACAGAACTGGAGCTGGTAAAATGTGGAATACAGATGTATTATGAGCTCAAAGTGGTGGATAAATTTCACATTCCACAAGAGGCCCTGGTGCGGTTCATGTACTCCCTGAGTAAGGGCTACCGCAAGATCACCTACCACAACTGGCGGCACGGCTTCAACGTGGGGCAGACCATGTTCTCCCTGCTGGTGACGGGAAAGCTGAAGCGCTACTTCACGGACCTAGAGGCCTTGGCCATGGTCACTGCTGCTTTCTGCCATGACATTGACCACAGAGGCACCAATAACCTCTACCAGATGAAATCCCAGAACCCACTGGCCAAGCTCCATGGGTCCTCTATCTTGGAAAGACACCACTTGGAGTTTGGCAAAACACTGCTCAGAGACGAGAGCCTGAATATCTTTCAAAACCTCAATCGTCGACAGCATGAGCATGCCATCCACATGATGGACATTGCAATCATTGCCACAGACCTCGCCCTGTATTTCAAGAAGAGGACGATGTTCCAAAAGATCGTGGATCAGTCTAAGACATATGAGAGTGAACAGGAGTGGACACAGTACATGATGCTGGAGCAGACACGGAAGGAAATCGTTATGGCCATGATGATGACCGCCTGTGATCTCTCAGCCATCACCAAACCCTGGGAGGTGCAGAGCCAGGTAGCTCTGCTGGTGGCTGCTGAATTCTGGGAACAAGGTGACCTGGAGCGCACGGTGCTGCAACAGAATCCCATTCCCATGATGGACAGAAACAAAGCAGATGAACTCCCTAAGCTTCAAGTCGGCTTCATTGACTTTGTTTGCACCTTCGTCTACAAGGAATTCTCCCGTTTCCACGAGGAGATCACCCCAATGTTGGACGGGATCACCAACAATCGCAAGGAGTGGAAGGCGCTTGCTGATGAGTACGATGCCAAGATGAAGGTGCAGGAGGAGAAGAAGCAGAAACAGCAGTCGGCCAAGTCAGCAGCCGCAGGAAATCAGCCGGGGGGAAACCCCAGCCCAGGGGGTGCAACTACATCCAAGTCCTGCTGCATCCAGTAA

Back to List