Details for gene: RBP3


proteolysis : The hydrolysis of proteins into smaller polypeptides and/or amino acids by cleavage of their peptide bonds. ; serine-type peptidase activity : Catalysis of the hydrolysis of peptide bonds in a polypeptide chain by a catalytic mechanism that involves a catalytic triad consisting of a serine nucleophile that is activated by a proton relay involving an acidic residue (e.g. aspartate or glutamate) and a basic residue (usually histidine). ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; interphotoreceptor matrix : A specialized extracellularc matrix that surrounds the photoreceptors of the retina and lies between them and the apical surface of the retinal pigment epithelium. The IPM has been implicated in several important activities required for photoreceptor function and maintenance. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; retinal binding : Interacting selectively and non-covalently with retinal, one of the forms of vitamin A. Retinal plays an important role in the visual process in most vertebrates, combining with opsins to form visual pigments in the retina. ; extracellular vesicle : Any vesicle that is part of the extracellular region. ; lipid metabolic process : The chemical reactions and pathways involving lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent. Includes fatty acids; neutral fats, other fatty-acid esters, and soaps; long-chain (fatty) alcohols and waxes; sphingoids and other long-chain bases; glycolipids, phospholipids and sphingolipids; and carotenes, polyprenols, sterols, terpenes and other isoprenoids. ; retinoid metabolic process : The chemical reactions and pathways involving retinoids, any member of a class of isoprenoids that contain or are derived from four prenyl groups linked head-to-tail. Retinoids include retinol and retinal and structurally similar natural derivatives or synthetic compounds, but need not have vitamin A activity. ; retinol binding : Interacting selectively and non-covalently with retinol, vitamin A1, 2,6,6-trimethyl-1-(9'-hydroxy-3',7'-dimethylnona-1',3',5',7'-tetraenyl)cyclohex-1-ene, one of the three components that makes up vitamin A. Retinol is an intermediate in the vision cycle and it also plays a role in growth and differentiation. ; retinoid binding : Interacting selectively and non-covalently with retinoids, any member of a class of isoprenoids that contain or are derived from four prenyl groups linked head-to-tail. Retinoids include retinol and retinal and structurally similar natural derivatives or synthetic compounds, but need not have vitamin A activity. ; cone matrix sheath : A biochemically and structurally distinct domain of the retinal interphotoreceptor matrix that is specifically associated with cone photoreceptor cell inner and outer segments. ;


Symbol
RBP3
Name
retinol binding protein 3
Entrez ID
5949
Ensembl ID
ENSG00000265203    (more details)
KEGG ID
hsa:5949    (more details)
OMIM ID
180290
Uniprot ID
P10745  
GO ID
hsa:5949    (more details)
Chromosome
1
Strand
1
Start
161766298
End
161977574
miRNA Interactions
hsa-miR-147a (RPM: 0.0014) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
The canonical retinoid cycle in rods (twilight vision) / The retinoid cycle in cones (daylight vision) /
Sequence
ATGATGAGAGAATGGGTTCTGCTCATGTCCGTGCTGCTCTGTGGCCTGGCTGGCCCCACACACCTGTTCCAGCCAAGCCTGGTGCTGGACATGGCCAAGGTCCTCTTGGATAACTACTGCTTCCCGGAGAACCTGCTGGGCATGCAGGAAGCCATCCAGCAGGCCATCAAGAGCCATGAGATTCTGAGCATCTCAGACCCGCAGACGCTGGCCAGTGTGCTGACAGCCGGGGTGCAGAGCTCCCTGAACGATCCTCGCCTGGTCATCTCCTATGAGCCCAGCACCCCCGAGCCTCCCCCACAAGTCCCAGCACTCACCAGCCTCTCAGAAGAGGAACTGCTTGCCTGGCTGCAAAGGGGCCTCCGCCATGAGGTTCTGGAGGGTAATGTGGGCTACCTGCGGGTGGACAGCGTCCCGGGCCAGGAGGTGCTGAGCATGATGGGGGAGTTCCTGGTGGCCCACGTGTGGGGGAATCTCATGGGCACCTCCGCCTTAGTGCTGGATCTCCGGCACTGCACAGGAGGCCAGGTCTCTGGCATTCCCTACATCATCTCCTACCTGCACCCAGGGAACACCATCCTGCACGTGGACACTATCTACAACCGCCCCTCCAACACCACCACGGAGATCTGGACCTTGCCCCAGGTCCTGGGAGAAAGGTACGGTGCCGACAAGGATGTGGTGGTCCTCACCAGCAGCCAGACCAGGGGCGTGGCCGAGGACATCGCGCACATCCTTAAGCAGATGCGCAGGGCCATCGTGGTGGGCGAGCGGACTGGGGGAGGGGCCCTGGACCTCCGGAAGCTGAGGATAGGCGAGTCTGACTTCTTCTTCACGGTGCCCGTGTCCAGGTCCCTGGGGCCCCTTGGTGGAGGCAGCCAGACGTGGGAGGGCAGCGGGGTGCTGCCCTGTGTGGGGACTCCGGCCGAGCAGGCCCTGGAGAAAGCCCTGGCCATCCTCACTCTGCGCAGCGCCCTTCCAGGGGTAGTCCACTGCCTCCAGGAGGTCCTGAAGGACTACTACACGCTGGTGGACCGTGTGCCCACCCTGCTGCAGCACTTGGCCAGCATGGACTTCTCCACGGTGGTCTCCGAGGAAGATCTGGTCACCAAGCTCAATGCCGGCCTGCAGGCTGCGTCTGAGGATCCCAGGCTCCTGGTGCGAGCCATCGGGCCCACAGAAACTCCTTCTTGGCCCGCGCCCGACGCTGCAGCCGAAGACTCACCAGGGGTGGCCCCAGAGTTGCCTGAGGACGAGGCTATCCGGCAAGCACTGGTGGACTCTGTGTTCCAGGTGTCGGTGCTGCCAGGCAATGTGGGCTACCTGCGCTTCGATAGTTTTGCTGACGCCTCCGTCCTGGGTGTGTTGGCCCCATATGTCCTGCGCCAGGTGTGGGAGCCGCTACAGGACACGGAGCACCTCATCATGGACCTGCGCCACAACCCTGGAGGGCCATCCTCTGCTGTGCCCCTGCTCCTGTCCTACTTCCAGGGCCCTGAGGCCGGCCCCGTGCACCTCTTCACCACCTATGATCGCCGCACCAACATCACGCAGGAGCACTTCAGCCACATGGAGCTCCCGGGCCCACGCTACAGCACCCAACGTGGGGTGTATCTGCTCACCAGCCACCGCACCGCCACGGCCGCGGAGGAGTTCGCCTTCCTTATGCAGTCGCTGGGCTGGGCCACACTGGTAGGTGAGATCACCGCGGGCAACCTGCTGCACACCCGCACGGTGCCGCTGCTGGACACACCCGAAGGCAGCCTCGCGCTCACCGTGCCGGTCCTCACCTTCATCGACAATCACGGCGAGGCCTGGCTGGGTGGTGGAGTGGTGCCCGATGCCATCGTGCTGGCCGAGGAGGCCCTGGACAAAGCCCAGGAAGTGCTGGAGTTCCACCAAAGCCTGGGGGCCTTGGTGGAGGGCACAGGGCACCTGCTGGAGGCCCACTATGCTCGGCCAGAGGTCGTGGGGCAGACCAGTGCCCTCCTGCGGGCCAAGCTGGCCCAGGGCGCCTACCGCACAGCTGTGGACTTGGAGTCTCTGGCCTCTCAGCTCACAGCAGACCTCCAGGAGGTGTCTGGGGACCACCGCTTGCTAGTGTTCCACAGCCCTGGCGAGCTGGTGGTAGAGGAAGCACCCCCACCACCCCCTGCTGTCCCCTCTCCAGAGGAGCTCACCTACCTTATTGAGGCCCTGTTCAAGACAGAGGTGCTGCCCGGCCAGCTGGGCTACCTGCGTTTTGACGCCATGGCTGAACTGGAGACAGTGAAGGCCGTGGGGCCACAGCTGGTGCGGCTGGTATGGCAACAGCTGGTGGACACGGCTGCGCTGGTGATCGACCTGCGCTACAACCCTGGCAGCTACTCCACGGCCATCCCGCTGCTCTGCTCCTACTTCTTTGAGGCAGAGCCCCGCCAGCACCTGTATTCTGTCTTTGACAGGGCCACCTCAAAAGTCACGGAGGTGTGGACCTTGCCCCAGGTCGCCGGCCAGCGCTACGGCTCACACAAGGACCTCTACATCCTGATGAGCCACACCAGTGGCTCTGCGGCCGAGGCCTTTGCACACACCATGCAGGACCTGCAGCGGGCCACGGTCATTGGGGAGCCCACGGCCGGAGGCGCACTCTCTGTGGGCATCTACCAGGTGGGCAGCAGCCCCTTATATGCATCCATGCCCACCCAGATGGCCATGAGTGCCACCACAGGCAAGGCCTGGGACCTGGCTGGTGTGGAGCCCGACATCACTGTGCCCATGAGCGAAGCCCTTTCCATAGCCCAGGACATAGTGGCTCTGCGTGCCAAGGTGCCCACGGTGCTGCAGACGGCCGGGAAGCTGGTGGCTGATAACTATGCCTCTGCCGAGCTGGGGGCCAAGATGGCCACCAAACTGAGCGGTCTGCAGAGCCGCTACTCCAGGGTGACCTCAGAAGTGGCCCTAGCCGAGATCCTGGGGGCTGACCTGCAGATGCTCTCCGGAGACCCACACCTGAAGGCAGCCCATATCCCTGAGAATGCCAAGGACCGCATTCCTGGAATTGTGCCCATGCAGATCCCTTCCCCTGAAGTATTTGAAGAGCTGATCAAGTTTTCCTTCCACACTAACGTGCTTGAGGACAACATTGGCTACTTGAGGTTTGACATGTTTGGGGACGGTGAGCTGCTCACCCAGGTCTCCAGGCTGCTGGTGGAGCACATCTGGAAGAAGATCATGCACACGGATGCCATGATCATCGACATGAGGTTCAACATCGGTGGCCCCACATCCTCCATTCCCATCTTGTGCTCCTACTTCTTTGATGAAGGCCCTCCAGTTCTGCTGGACAAGATCTACAGCCGGCCTGATGACTCTGTCAGTGAACTCTGGACACACGCCCAGGTTGTAGGTGAACGCTATGGCTCCAAGAAGAGCATGGTCATTCTGACCAGCAGTGTGACGGCCGGCACCGCGGAGGAGTTCACCTATATCATGAAGAGGCTGGGCCGGGCCCTGGTCATTGGGGAGGTGACCAGTGGGGGCTGCCAGCCACCACAGACCTACCACGTGGATGACACCAACCTCTACCTCACTATCCCCACGGCCCGTTCTGTGGGGGCCTCGGATGGCAGCTCCTGGGAAGGGGTGGGGGTGACACCCCATGTGGTTGTCCCTGCAGAAGAGGCTCTCGCCAGGGCCAAGGAGATGCTCCAGCACAACCAGCTGAGGGTGAAGCGGAGCCCAGGCCTGCAGGACCACCTGTAG

Back to List