Details for gene: RBP4


retinoid binding : Interacting selectively and non-covalently with retinoids, any member of a class of isoprenoids that contain or are derived from four prenyl groups linked head-to-tail. Retinoids include retinol and retinal and structurally similar natural derivatives or synthetic compounds, but need not have vitamin A activity. ; retinol transmembrane transporter activity : Enables the transfer of retinol from one side of a membrane to the other. Retinol is vitamin A1, 2,6,6-trimethyl-1-(9'-hydroxy-3',7'-dimethylnona-1',3',5',7'-tetraenyl)cyclohex-1-ene, one of the three components that makes up vitamin A. ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; retinal binding : Interacting selectively and non-covalently with retinal, one of the forms of vitamin A. Retinal plays an important role in the visual process in most vertebrates, combining with opsins to form visual pigments in the retina. ; retinol binding : Interacting selectively and non-covalently with retinol, vitamin A1, 2,6,6-trimethyl-1-(9'-hydroxy-3',7'-dimethylnona-1',3',5',7'-tetraenyl)cyclohex-1-ene, one of the three components that makes up vitamin A. Retinol is an intermediate in the vision cycle and it also plays a role in growth and differentiation. ; positive regulation of insulin secretion : Any process that activates or increases the frequency, rate or extent of the regulated release of insulin. ; heart development : The process whose specific outcome is the progression of the heart over time, from its formation to the mature structure. The heart is a hollow, muscular organ, which, by contracting rhythmically, keeps up the circulation of the blood. ; response to retinoic acid : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a retinoic acid stimulus. ; lung development : The process whose specific outcome is the progression of the lung over time, from its formation to the mature structure. In all air-breathing vertebrates the lungs are developed from the ventral wall of the oesophagus as a pouch which divides into two sacs. In amphibians and many reptiles the lungs retain very nearly this primitive sac-like character, but in the higher forms the connection with the esophagus becomes elongated into the windpipe and the inner walls of the sacs become more and more divided, until, in the mammals, the air spaces become minutely divided into tubes ending in small air cells, in the walls of which the blood circulates in a fine network of capillaries. In mammals the lungs are more or less divided into lobes, and each lung occupies a separate cavity in the thorax. ; glucose homeostasis : Any process involved in the maintenance of an internal steady state of glucose within an organism or cell. ; heart trabecula formation : The process of creating a trabecula in the heart. A trabecula is a tissue element in the form of a small beam, strut or rod. ; eye development : The process whose specific outcome is the progression of the eye over time, from its formation to the mature structure. The eye is the organ of sight. ; positive regulation of immunoglobulin production : Any process that activates or increases the frequency, rate, or extent of immunoglobulin production. ; gluconeogenesis : The formation of glucose from noncarbohydrate precursors, such as pyruvate, amino acids and glycerol. ; maintenance of gastrointestinal epithelium : Protection of epithelial surfaces of the gastrointestinal tract from proteolytic and caustic digestive agents. ; retinol transport : The directed movement of retinol into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. Retinol is vitamin A1, 2,6,6-trimethyl-1-(9'-hydroxy-3',7'-dimethylnona-1',3',5',7'-tetraenyl)cyclohex-1-ene, one of the three components that makes up vitamin A. ; retinol metabolic process : The chemical reactions and pathways involving retinol, one of the three compounds that makes up vitamin A. ; embryonic organ morphogenesis : Morphogenesis, during the embryonic phase, of a tissue or tissues that work together to perform a specific function or functions. Morphogenesis is the process in which anatomical structures are generated and organized. Organs are commonly observed as visibly distinct structures, but may also exist as loosely associated clusters of cells that work together to perform a specific function or functions. ; embryonic skeletal system development : The process, occurring during the embryonic phase, whose specific outcome is the progression of the skeleton over time, from its formation to the mature structure. ; cardiac muscle tissue development : The process whose specific outcome is the progression of cardiac muscle over time, from its formation to the mature structure. ; female genitalia morphogenesis : The process in which the anatomical structures of female genitalia are generated and organized. ; negative regulation of cardiac muscle cell proliferation : Any process that stops, prevents, or reduces the frequency, rate or extent of cardiac muscle cell proliferation. ; embryonic retina morphogenesis in camera-type eye : The process in which the anatomical structure of the retina is generated and organized in a camera-type eye during the embryonic life stage. ; uterus development : The reproductive developmental process whose specific outcome is the progression of the uterus over time, from its formation to the mature structure. ; vagina development : The reproductive developmental process whose specific outcome is the progression of the vagina over time, from its formation to the mature structure. ; urinary bladder development : The process whose specific outcome is the progression of the urinary bladder over time, from its formation to the mature structure. The urinary bladder is an elastic, muscular sac situated in the anterior part of the pelvic cavity in which urine collects before excretion. ;


Symbol
RBP4
Name
retinol binding protein 4
Entrez ID
5950
Ensembl ID
ENSG00000138207    (more details)
KEGG ID
hsa:5950    (more details)
OMIM ID
180250
Uniprot ID
P02753  
GO ID
hsa:5950    (more details)
Chromosome
11
Strand
-1
Start
61950063
End
61965515
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-452-5p (RPM: 23.696) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-146a-5p (RPM: 774.8698) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Retinoid cycle disease events / The canonical retinoid cycle in rods (twilight vision) / Retinoid metabolism and transport / Retinoid metabolism disease events /
Sequence
ATGAAGTGGGTGTGGGCGCTCTTGCTGTTGGCGGCGCTGGGCAGCGGCCGCGCGGAGCGCGACTGCCGAGTGAGCAGCTTCCGAGTCAAGGAGAACTTCGACAAGGCTCGCTTCTCTGGGACCTGGTACGCCATGGCCAAGAAGGACCCCGAGGGCCTCTTTCTGCAGGACAACATCGTCGCGGAGTTCTCCGTGGACGAGACCGGCCAGATGAGCGCCACAGCCAAGGGCCGAGTCCGTCTTTTGAATAACTGGGACGTGTGCGCAGACATGGTGGGCACCTTCACAGACACCGAGGACCCTGCCAAGTTCAAGATGAAGTACTGGGGCGTAGCCTCCTTTCTCCAGAAAGGAAATGATGACCACTGGATCGTCGACACAGACTACGACACGTATGCCGTGCAGTACTCCTGCCGCCTCCTGAACCTCGATGGCACCTGTGCTGACAGCTACTCCTTCGTGTTTTCCCGGGACCCCAACGGCCTGCCCCCAGAAGCGCAGAAGATTGTAAGGCAGCGGCAGGAGGAGCTGTGCCTGGCCAGGCAGTACAGGCTGATCGTCCACAACGGTTACTGCGATGGCAGATCAGAAAGAAACCTTTTGTAG

Back to List