Details for gene: RGR


G protein-coupled receptor signaling pathway : A series of molecular signals that proceeds with an activated receptor promoting the exchange of GDP for GTP on the alpha-subunit of an associated heterotrimeric G-protein complex. The GTP-bound activated alpha-G-protein then dissociates from the beta- and gamma-subunits to further transmit the signal within the cell. The pathway begins with receptor-ligand interaction, or for basal GPCR signaling the pathway begins with the receptor activating its G protein in the absence of an agonist, and ends with regulation of a downstream cellular process, e.g. transcription. The pathway can start from the plasma membrane, Golgi or nuclear membrane. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; G protein-coupled receptor activity : Combining with an extracellular signal and transmitting the signal across the membrane by activating an associated G-protein; promotes the exchange of GDP for GTP on the alpha subunit of a heterotrimeric G-protein complex. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; phototransduction : The sequence of reactions within a cell required to convert absorbed photons into a molecular signal. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; signal transduction : The cellular process in which a signal is conveyed to trigger a change in the activity or state of a cell. Signal transduction begins with reception of a signal (e.g. a ligand binding to a receptor or receptor activation by a stimulus such as light), or for signal transduction in the absence of ligand, signal-withdrawal or the activity of a constitutively active receptor. Signal transduction ends with regulation of a downstream cellular process, e.g. regulation of transcription or regulation of a metabolic process. Signal transduction covers signaling from receptors located on the surface of the cell and signaling via molecules located within the cell. For signaling between cells, signal transduction is restricted to events at and within the receiving cell. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; photoreceptor activity : The function of absorbing and responding to incidental electromagnetic radiation, particularly visible light. The response may involve a change in conformation. ; protein-chromophore linkage : The covalent or noncovalent attachment of a chromophore to a protein. ; integral component of plasma membrane : The component of the plasma membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; G protein-coupled photoreceptor activity : Combining with incidental electromagnetic radiation, particularly visible light, and transmitting the signal across the membrane by activating an associated G-protein; promotes the exchange of GDP for GTP on the alpha subunit of a heterotrimeric G-protein complex. ; detection of visible light : The series of events in which a visible light stimulus is received by a cell and converted into a molecular signal. A visible light stimulus is electromagnetic radiation that can be perceived visually by an organism; for organisms lacking a visual system, this can be defined as light with a wavelength within the range 380 to 780 nm. ; cellular response to light stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a light stimulus, electromagnetic radiation of wavelengths classified as infrared, visible or ultraviolet light. ;


Symbol
RGR
Name
retinal G protein coupled receptor
Entrez ID
5995
Ensembl ID
ENSG00000148604    (more details)
KEGG ID
hsa:5995    (more details)
OMIM ID
600342
Uniprot ID
P47804  
GO ID
hsa:5995    (more details)
Chromosome
3
Strand
1
Start
150926163
End
150972727
miRNA Interactions
hsa-miR-5683 (RPM: 3.235) / hsa-miR-3133 (RPM: 0.0266) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-509-3p (RPM: 31.2006) / hsa-miR-421 (RPM: 76.7678) / hsa-miR-1261 (RPM: 0.0038) / hsa-miR-424-3p (RPM: 2.2264) / hsa-miR-4709-5p (RPM: 1.1454) / hsa-miR-1245b-3p (RPM: 0.1634) / hsa-miR-6884-3p (RPM: 0.0372) / hsa-miR-7151-5p (RPM: 0.0134) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
G alpha (i) signalling events / Opsins /
Sequence
ATGGCAGAGACCAGTGCCCTGCCCACTGGCTTCGGGGAGCTCGAGGTGCTGGCTGTGGGGATGGTGCTACTGGTGGAAGCTCTCTCCGGTCTCAGCCTCAATACCCTGACCATCTTCTCTTTCTGCAAGACCCCGGAGCTGCGGACTCCCTGCCACCTACTGGTGCTGAGCTTGGCTCTTGCGGACAGTGGGATCAGCCTGAATGCCCTCGTTGCAGCCACATCCAGCCTTCTCCGGCGCTGGCCCTACGGCTCGGACGGCTGCCAGGCTCACGGCTTCCAGGGCTTTGTGACAGCGTTGGCCAGCATCTGCAGCAGTGCAGCCATCGCATGGGGGCGTTATCACCACTACTGCACCCGTAGCCAGCTGGCCTGGAACTCAGCCGTCTCTCTGGTGCTCTTCGTGTGGCTGTCTTCTGCCTTCTGGGCAGCTCTGCCCCTTCTGGGTTGGGGTCACTACGACTATGAGCCACTGGGGACATGCTGCACCCTGGACTACTCCAAGGGGGACAGAAACTTCACCAGCTTCCTCTTCACCATGTCCTTCTTCAACTTCGCCATGCCCCTCTTCATCACGATCACTTCCTACAGTCTCATGGAGCAGAAACTGGGGAAGAGTGGCCATCTCCAGGTAAACACCACTCTGCCAGCAAGGACGCTGCTGCTCGGCTGGGGCCCCTATGCCATCCTGTATCTATACGCAGTCATCGCAGACGTGACTTCCATCTCCCCCAAACTGCAGATGGTGCCCGCCCTCATTGCCAAAATGGTGCCCACGATCAATGCCATCAACTATGCCCTGGGCAATGAGATGGTCTGCAGGGGAATCTGGCAGTGCCTCTCACCGCAGAAGAGGGAGAAGGACCGAACCAAGTGA

Back to List