Details for gene: RHO


G protein-coupled receptor signaling pathway : A series of molecular signals that proceeds with an activated receptor promoting the exchange of GDP for GTP on the alpha-subunit of an associated heterotrimeric G-protein complex. The GTP-bound activated alpha-G-protein then dissociates from the beta- and gamma-subunits to further transmit the signal within the cell. The pathway begins with receptor-ligand interaction, or for basal GPCR signaling the pathway begins with the receptor activating its G protein in the absence of an agonist, and ends with regulation of a downstream cellular process, e.g. transcription. The pathway can start from the plasma membrane, Golgi or nuclear membrane. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; G protein-coupled receptor activity : Combining with an extracellular signal and transmitting the signal across the membrane by activating an associated G-protein; promotes the exchange of GDP for GTP on the alpha subunit of a heterotrimeric G-protein complex. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; phototransduction : The sequence of reactions within a cell required to convert absorbed photons into a molecular signal. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; signal transduction : The cellular process in which a signal is conveyed to trigger a change in the activity or state of a cell. Signal transduction begins with reception of a signal (e.g. a ligand binding to a receptor or receptor activation by a stimulus such as light), or for signal transduction in the absence of ligand, signal-withdrawal or the activity of a constitutively active receptor. Signal transduction ends with regulation of a downstream cellular process, e.g. regulation of transcription or regulation of a metabolic process. Signal transduction covers signaling from receptors located on the surface of the cell and signaling via molecules located within the cell. For signaling between cells, signal transduction is restricted to events at and within the receiving cell. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; photoreceptor activity : The function of absorbing and responding to incidental electromagnetic radiation, particularly visible light. The response may involve a change in conformation. ; protein-chromophore linkage : The covalent or noncovalent attachment of a chromophore to a protein. ; integral component of plasma membrane : The component of the plasma membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; photoreceptor disc membrane : Stack of disc membranes located inside a photoreceptor outer segment, and containing densely packed molecules of photoreceptor proteins that traverse the lipid bilayer. Disc membranes arise as evaginations of the ciliary membrane during the development of the outer segment and may or may not remain contiguous with the ciliary membrane. ; Golgi membrane : The lipid bilayer surrounding any of the compartments of the Golgi apparatus. ; Golgi apparatus : A membrane-bound cytoplasmic organelle of the endomembrane system that further processes the core oligosaccharides (e.g. N-glycans) added to proteins in the endoplasmic reticulum and packages them into membrane-bound vesicles. The Golgi apparatus operates at the intersection of the secretory, lysosomal, and endocytic pathways. ; G protein-coupled photoreceptor activity : Combining with incidental electromagnetic radiation, particularly visible light, and transmitting the signal across the membrane by activating an associated G-protein; promotes the exchange of GDP for GTP on the alpha subunit of a heterotrimeric G-protein complex. ; cellular response to light stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a light stimulus, electromagnetic radiation of wavelengths classified as infrared, visible or ultraviolet light. ; 11-cis retinal binding : Interacting selectively and non-covalently with 11-cis retinal, an isomer of retinal that plays an important role in the visual process in most vertebrates. 11-cis retinal combines with opsin in the rods (scotopsin) to form rhodopsin or visual purple. Retinal is one of the three compounds that makes up vitamin A. ; protein phosphorylation : The process of introducing a phosphate group on to a protein. ; phototransduction, visible light : The sequence of reactions within a cell required to convert absorbed photons from visible light into a molecular signal. A visible light stimulus is electromagnetic radiation that can be perceived visually by an organism; for organisms lacking a visual system, this can be defined as light with a wavelength within the range 380 to 780 nm. ; response to light stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a light stimulus, electromagnetic radiation of wavelengths classified as infrared, visible or ultraviolet light. ; detection of light stimulus : The series of events in which a light stimulus (in the form of photons) is received and converted into a molecular signal. ; absorption of visible light : The reception of a (visible light) photon by a cell, visible light being defined as having a wavelength within the range 380-780 nm. ; rhodopsin mediated signaling pathway : The series of molecular signals generated as a consequence of excitation of rhodopsin by a photon and the events that convert the absorbed photons into a cellular response. ; thermotaxis : The directed movement of a motile cell or organism in response to a temperature gradient. Movement may be towards either a higher or lower temperature. ; photoreceptor cell maintenance : Any process preventing the degeneration of the photoreceptor, a specialized cell type that is sensitive to light. ; sensory perception of light stimulus : The series of events required for an organism to receive a sensory light stimulus, convert it to a molecular signal, and recognize and characterize the signal. This is a neurological process. ; detection of temperature stimulus involved in thermoception : The series of events in which a temperature stimulus is received and converted into a molecular signal as part of thermoception. ; retina development in camera-type eye : The process whose specific outcome is the progression of the retina over time, from its formation to the mature structure. The retina is the innermost layer or coating at the back of the eyeball, which is sensitive to light and in which the optic nerve terminates. ; photoreceptor inner segment : The inner segment of a vertebrate photoreceptor containing mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ; Golgi-associated vesicle membrane : The lipid bilayer surrounding a vesicle associated with the Golgi apparatus. ; ciliary membrane : The portion of the plasma membrane surrounding a cilium. ; cell-cell junction : A cell junction that forms a connection between two or more cells in a multicellular organism; excludes direct cytoplasmic intercellular bridges, such as ring canals in insects. ; photoreceptor outer segment membrane : The membrane surrounding the outer segment of a vertebrate photoreceptor. ; photoreceptor inner segment membrane : The membrane surrounding the inner segment of a vertebrate photoreceptor. The photoreceptor inner segment contains mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ; sperm midpiece : The highly organized segment of the sperm flagellum which begins at the connecting piece and is characterized by the presence of 9 outer dense fibers (ODFs) that lie outside each of the 9 outer axonemal microtubule doublets and by a sheath of mitochondria that encloses the ODFs and the axoneme; the midpiece terminates about one-fourth of the way down the sperm flagellum at the annulus, which marks the beginning of the principal piece. ; sperm head plasma membrane : The plasma membrane that is part of the head section of a sperm cell. ;


Symbol
RHO
Name
rhodopsin
Entrez ID
6010
Ensembl ID
ENSG00000163914    (more details)
KEGG ID
hsa:6010    (more details)
OMIM ID
136880
Uniprot ID
P08100  
GO ID
hsa:6010    (more details)
Chromosome
1
Strand
1
Start
197268204
End
197478455
miRNA Interactions
hsa-miR-21-5p (RPM: 5494.851) / hsa-miR-146a-5p (RPM: 774.8698) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Phototransduction /
Sequence
ATGAATGGCACAGAAGGCCCTAACTTCTACGTGCCCTTCTCCAATGCGACGGGTGTGGTACGCAGCCCCTTCGAGTACCCACAGTACTACCTGGCTGAGCCATGGCAGTTCTCCATGCTGGCCGCCTACATGTTTCTGCTGATCGTGCTGGGCTTCCCCATCAACTTCCTCACGCTCTACGTCACCGTCCAGCACAAGAAGCTGCGCACGCCTCTCAACTACATCCTGCTCAACCTAGCCGTGGCTGACCTCTTCATGGTCCTAGGTGGCTTCACCAGCACCCTCTACACCTCTCTGCATGGATACTTCGTCTTCGGGCCCACAGGATGCAATTTGGAGGGCTTCTTTGCCACCCTGGGCGGTGAAATTGCCCTGTGGTCCTTGGTGGTCCTGGCCATCGAGCGGTACGTGGTGGTGTGTAAGCCCATGAGCAACTTCCGCTTCGGGGAGAACCATGCCATCATGGGCGTTGCCTTCACCTGGGTCATGGCGCTGGCCTGCGCCGCACCCCCACTCGCCGGCTGGTCCAGGTACATCCCCGAGGGCCTGCAGTGCTCGTGTGGAATCGACTACTACACGCTCAAGCCGGAGGTCAACAACGAGTCTTTTGTCATCTACATGTTCGTGGTCCACTTCACCATCCCCATGATTATCATCTTTTTCTGCTATGGGCAGCTCGTCTTCACCGTCAAGGAGGCCGCTGCCCAGCAGCAGGAGTCAGCCACCACACAGAAGGCAGAGAAGGAGGTCACCCGCATGGTCATCATCATGGTCATCGCTTTCCTGATCTGCTGGGTGCCCTACGCCAGCGTGGCATTCTACATCTTCACCCACCAGGGCTCCAACTTCGGTCCCATCTTCATGACCATCCCAGCGTTCTTTGCCAAGAGCGCCGCCATCTACAACCCTGTCATCTATATCATGATGAACAAGCAGTTCCGGAACTGCATGCTCACCACCATCTGCTGCGGCAAGAACCCACTGGGTGACGATGAGGCCTCTGCTACCGTGTCCAAGACGGAGACGAGCCAGGTGGCCCCGGCCTAA

Back to List