Details for gene: ROM1


integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; cell adhesion : The attachment of a cell, either to another cell or to an underlying substrate such as the extracellular matrix, via cell adhesion molecules. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; integral component of plasma membrane : The component of the plasma membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; protein homodimerization activity : Interacting selectively and non-covalently with an identical protein to form a homodimer. ; regulation of gene expression : Any process that modulates the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form. ; photoreceptor cell outer segment organization : A process that is carried out at the cellular level and results in the assembly, arrangement of constituent parts, or disassembly of the outer segment of a photoreceptor cell, a sensory cell that reacts to the presence of light. The outer segment of the photoreceptor cell contains the light-absorbing materials. ; detection of light stimulus involved in visual perception : The series of events involved in visual perception in which a light stimulus is received and converted into a molecular signal. ; protein homooligomerization : The process of creating protein oligomers, compounds composed of a small number, usually between three and ten, of identical component monomers. Oligomers may be formed by the polymerization of a number of monomers or the depolymerization of a large protein polymer. ; protein heterooligomerization : The process of creating protein oligomers, compounds composed of a small number, usually between three and ten, of component monomers that are not all identical. Oligomers may be formed by the polymerization of a number of monomers or the depolymerization of a large protein polymer. ; retina development in camera-type eye : The process whose specific outcome is the progression of the retina over time, from its formation to the mature structure. The retina is the innermost layer or coating at the back of the eyeball, which is sensitive to light and in which the optic nerve terminates. ; retina morphogenesis in camera-type eye : The process in which the anatomical structure of the retina is generated and organized. ; camera-type eye photoreceptor cell differentiation : The process in which a relatively unspecialized cell acquires the specialized features of a photoreceptor cell in a camera-type eye. ; retina vasculature development in camera-type eye : The process whose specific outcome is the progression of the vasculature of the retina over time, from its formation to the mature structure. ; protein localization to photoreceptor outer segment : A process in which a protein is transported to, or maintained in, a location within a photoreceptor outer segment. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; photoreceptor outer segment membrane : The membrane surrounding the outer segment of a vertebrate photoreceptor. ;


Symbol
ROM1
Name
retinal outer segment membrane protein 1
Entrez ID
6094
Ensembl ID
ENSG00000149489    (more details)
KEGG ID
hsa:6094    (more details)
OMIM ID
180721
Uniprot ID
Q03395  
GO ID
hsa:6094    (more details)
Chromosome
1
Strand
1
Start
16740273
End
16972964
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-31-5p (RPM: 310.1326) / hsa-miR-146a-5p (RPM: 774.8698) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGGCGCCGGTGTTGCCCCTGGTGCTGCCCCTGCAGCCCCGCATCCGCCTGGCACAAGGGCTCTGGCTCCTCTCCTGGCTGCTGGCGCTGGCTGGTGGCGTCATCCTCCTCTGTAGTGGGCACCTCCTGGTCCAGCTAAGGCACCTTGGCACCTTCCTGGCTCCCTCCTGTCAGTTCCCTGTCCTGCCCCAGGCTGCCCTGGCAGCGGGCGCGGTGGCTCTGGGCACAGGACTAGTGGGTGTAGGAGCCAGCCGGGCAAGTCTGAATGCAGCTCTATACCCTCCCTGGCGAGGGGTCCTGGGCCCGCTGCTGGTGGCTGGCACGGCTGGTGGGGGGGGGCTCCTGGTCGTCGGCCTCGGGCTAGCCCTGGCTTTGCCTGGGAGTCTGGATGAGGCGCTGGAGGAGGGCCTGGTGACTGCCTTGGCTCACTACAAGGACACAGAGGTGCCTGGGCACTGTCAGGCCAAAAGGCTGGTGGATGAGCTGCAACTGAGGTACCACTGCTGCGGGCGCCACGGGTACAAGGATTGGTTTGGGGTCCAGTGGGTCAGCAGCCGTTACCTGGATCCCGGTGACCGGGATGTGGCTGACCGGATCCAGAGCAATGTAGAAGGCCTATACCTGACTGATGGGGTCCCTTTCTCCTGTTGCAACCCCCACTCACCCCGGCCTTGCCTGCAAAACCGTCTTTCAGACTCCTACGCCCACCCCCTGTTCGATCCCCGACAACCCAACCAAAACCTCTGGGCCCAAGGGTGCCATGAGGTGCTGCTGGAGCACTTGCAGGACTTGGCAGGCACACTGGGTAGCATGCTGGCTGTCACCTTCCTACTGCAGGCTCTGGTGCTCCTTGGCCTGCGGTACCTGCAAACAGCACTGGAGGGGCTTGGAGGGGTCATTGATGCGGGAGGAGAGACCCAGGGCTATCTCTTTCCCAGTGGGCTGAAAGATATGCTGAAAACAGCATGGCTACAGGGAGGGGTTGCCTGCAGGCCAGCACCTGAGGAGGCCCCACCAGGAGAAGCACCTCCCAAGGAGGATCTATCTGAGGCCTAG

Back to List