Details for gene: RP9


RNA splicing : The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA. ; RNA binding : Interacting selectively and non-covalently with an RNA molecule or a portion thereof. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; signal recognition particle receptor complex : A transmembrane heterodimeric protein located in the membrane of the rough endoplasmic reticulum. Both subunits contain GTPase domains with which signal recognition particle interacts. In the presence of GTP and SRP receptor, SRP is released from the ribosome-nascent chain complex. ; cognition : The operation of the mind by which an organism becomes aware of objects of thought or perception; it includes the mental activities associated with thinking, learning, and memory. ;


Symbol
RP9
Name
RP9 pre-mRNA splicing factor
Entrez ID
6100
Ensembl ID
ENSG00000164610    (more details)
KEGG ID
hsa:6100    (more details)
OMIM ID
180104
Uniprot ID
A0A090N8Z0  
GO ID
hsa:6100    (more details)
Chromosome
16
Strand
-1
Start
72093613
End
72112912
miRNA Interactions
hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-3199 (RPM: 0.1412) / hsa-miR-191-5p (RPM: 12993.8088) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGTCGTCCCGGCCTGGGCGCGAGGACGTGGGGGCTGCGGGCGCGCGGCGGCCGCGTGAGCCGCCGGAGCAGGAGCTGCAGCGACGTCGGGAGCAGAAGCGGCGGCGACACGACGCGCAGCAGCTGCAGCAGCTCAAGCACCTGGAGTCCTTTTACGAAAAACCTCCTCCTGGGCTTATCAAGGAAGATGAGACTAAGCCAGAAGATTGCATACCAGATGTACCAGGCAATGAACACGCCAGGGAATTTCTGGCTCATGCACCAACTAAAGGACTTTGGATGCCACTGGGGAAAGAAGTCAAAGTTATGCAGTGTTGGCGTTGCAAACGCTATGGTCACCGAACGGGTGACAAAGAATGCCCTTTCTTTATCAAAGGCAACCAAAAGTTAGAGCAGTTCAGAGTGGCACATGAAGATCCCATGTATGACATCATACGAGACAATAAACGACATGAAAAGGACGTAAGGATACAGCAGTTAAAACAGTTACTGGAGGATTCTACCTCAGATGAAGATAGGAGCAGCTCCAGTTCCTCTGAAGGTAAAGAGAAACACAAGAAAAAGAAGAAGAAAGAAAAGCATAAGAAAAGGAAGAAAGAAAAGAAAAAGAAGAAAAAACGGAAGCACAAATCTTCCAAGTCAAATGAGGGTTCTGACTCAGAGTGA

Back to List