Details for gene: RP1


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; intracellular signal transduction : The process in which a signal is passed on to downstream components within the cell, which become activated themselves to further propagate the signal and finally trigger a change in the function or state of the cell. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; microtubule : Any of the long, generally straight, hollow tubes of internal diameter 12-15 nm and external diameter 24 nm found in a wide variety of eukaryotic cells; each consists (usually) of 13 protofilaments of polymeric tubulin, staggered in such a manner that the tubulin monomers are arranged in a helical pattern on the microtubular surface, and with the alpha/beta axes of the tubulin subunits parallel to the long axis of the tubule; exist in equilibrium with pool of tubulin monomers and can be rapidly assembled or disassembled in response to physiological stimuli; concerned with force generation, e.g. in the spindle. ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; cell projection organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a prolongation or process extending from a cell, e.g. a flagellum or axon. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; microtubule binding : Interacting selectively and non-covalently with microtubules, filaments composed of tubulin monomers. ; photoreceptor inner segment : The inner segment of a vertebrate photoreceptor containing mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ; microtubule associated complex : Any multimeric complex connected to a microtubule. ; axoneme assembly : The assembly and organization of an axoneme, the bundle of microtubules and associated proteins that forms the core of cilia (also called flagella) in eukaryotic cells and is responsible for their movements. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; axoneme : The bundle of microtubules and associated proteins that forms the core of cilia (also called flagella) in eukaryotic cells and is responsible for their movements. ; photoreceptor cell maintenance : Any process preventing the degeneration of the photoreceptor, a specialized cell type that is sensitive to light. ; photoreceptor cell development : Development of a photoreceptor, a cell that responds to incident electromagnetic radiation, particularly visible light. ; retina development in camera-type eye : The process whose specific outcome is the progression of the retina over time, from its formation to the mature structure. The retina is the innermost layer or coating at the back of the eyeball, which is sensitive to light and in which the optic nerve terminates. ; retinal cone cell development : Development of a cone cell, one of the sensory cells in the eye that reacts to the presence of light. Cone cells contain the photopigment iodopsin or cyanopsin and are responsible for photopic (daylight) vision. ; phototransduction, visible light : The sequence of reactions within a cell required to convert absorbed photons from visible light into a molecular signal. A visible light stimulus is electromagnetic radiation that can be perceived visually by an organism; for organisms lacking a visual system, this can be defined as light with a wavelength within the range 380 to 780 nm. ; photoreceptor cell outer segment organization : A process that is carried out at the cellular level and results in the assembly, arrangement of constituent parts, or disassembly of the outer segment of a photoreceptor cell, a sensory cell that reacts to the presence of light. The outer segment of the photoreceptor cell contains the light-absorbing materials. ; retinal rod cell development : Development of a rod cell, one of the sensory cells in the eye that reacts to the presence of light. Rod cells contain the photopigment rhodopsin or porphyropsin and are responsible for vision in dim light. ; retina morphogenesis in camera-type eye : The process in which the anatomical structure of the retina is generated and organized. ; cellular response to light stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a light stimulus, electromagnetic radiation of wavelengths classified as infrared, visible or ultraviolet light. ; positive regulation of non-motile cilium assembly : Any process that activates or increases the frequency, rate or extent of non-motile cilium assembly. ; photoreceptor connecting cilium : The portion of the photoreceptor cell cilium linking the photoreceptor inner and outer segments. It's considered to be equivalent to the ciliary transition zone. ; ciliary tip : Part of the cilium where the axoneme ends. The ciliary tip has been implicated in ciliary assembly and disassembly, as well as signal transduction. ; photoreceptor cell cilium : A specialised 9+0 non-motile cilium found in photoreceptor cells. A ciliary transition zone called 'photoreceptor connecting cilium' links the photoreceptor outer segment to the inner segment. ;


Symbol
RP1
Name
RP1 axonemal microtubule associated
Entrez ID
6101
Ensembl ID
ENSG00000104237    (more details)
KEGG ID
hsa:6101    (more details)
OMIM ID
180100
Uniprot ID
P56715  
GO ID
hsa:6101    (more details)
Chromosome
16
Strand
1
Start
1510427
End
1612072
miRNA Interactions
hsa-miR-335-5p (RPM: 265.7294) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGAGTGATACCCCTTCTACTGGTTTTTCCATCATTCATCCTACGTCTTCTGAAGGTCAAGTTCCACCCCCTCGCCATTTGAGCCTCACTCATCCTGTTGTGGCCAAGCGAATCAGTTTCTACAAGAGCGGAGACCCCCAATTCGGCGGGGTCAGGGTGGTGGTCAACCCTCGCTCCTTTAAGTCCTTTGATGCTCTGCTGGATAACTTGTCCAGGAAGGTGCCCCTCCCTTTTGGAGTGAGGAACATCAGCACCCCTCGGGGCAGGCACAGCATCACGCGCCTGGAGGAGCTGGAGGACGGCGAGTCCTACCTATGTTCCCACGGCAGGAAGGTGCAGCCTGTAGACCTGGACAAAGCCCGTCGGCGCCCGCGGCCCTGGCTCAGCAGCCGGGCCATTAGCGCGCACTCACCGCCCCACCCCGTAGCCGTCGCTGCTCCCGGCATGCCCCGCCCCCCACGGAGCCTAGTGGTCTTCAGGAATGGCGACCCGAAGACGAGGCGTGCGGTTCTTCTGAGCAGGAGGGTCACCCAGAGCTTCGAGGCATTTCTACAGCACCTGACAGAGGTCATGCAGCGCCCTGTGGTCAAGCTGTACGCTACGGACGGAAGGAGGGTTCCCAGCCTCCAGGCAGTGATCCTGAGCTCTGGAGCTGTGGTGGCGGCAGGAAGGGAGCCATTTAAACCAGGAAATTATGACATCCAAAAATACTTGCTTCCTGCTAGATTACCAGGGATCTCTCAGCGTGTGTACCCCAAGGGAAATGCAAAGTCAGAAAGCAGAAAGATAAGCACACATATGTCTTCAAGCTCAAGGTCCCAGATTTATTCTGTTTCTTCTGAGAAAACACATAATAATGATTGCTACTTAGACTATTCTTTTGTTCCTGAAAAGTACTTGGCCTTAGAAAAGAATGATTCTCAGAATTTACCAATATATCCTTCTGAAGATGATATTGAGAAATCAATTATTTTTAATCAAGACGGCACTATGACAGTTGAGATGAAAGTTCGATTCAGAATAAAAGAGGAAGAAACCATAAAATGGACAACTACTGTCAGTAAAACTGGTCCTTCTAATAATGATGAAAAGAGTGAGATGAGTTTTCCAGGAAGAACAGAAAGTCGATCATCTGGTTTAAAGCTTGCAGCATGTTCATTCTCTGCAGATGTGTCACCTATGGAGCGAAGCAGTAATCAAGAGGGCAGTTTGGCAGAGGAGATAAACATTCAAATGACAGATCAAGTGGCTGAAACTTGCAGTTCTGCTAGTTGGGAGAATGCTACTGTGGACACAGATATCATCCAGGGAACTCAAGACCAAGCAAAGCATCGTTTTTATAGGCCCCCTACACCTGGACTAAGAAGAGTGAGACAAAAGAAATCTGTGATTGGCAGTGTGACCTTAGTATCTGAAACTGAGGTTCAAGAGAAAATGATTGGACAGTTTTCATATAGTGAAGAAAGGGAAAGTGGGGAAAACAAGTCTGAGTATCACATGTTTACACATTCTTGCAGTAAAATGTCATCAGTATCTAACAAACCAGTACTTGTTCAGATCAATAACAATGATCAAATGGAGGAGTCATCATTAGAAAGAAAAAAGGAAAACAGTCTGCTTAAGTCAAGTGCAATAAGTGCTGGTGTTATAGAAATTACAAGTCAGAAGATGTTAGAGATGTCACATAATAATGGTTTGCCATCAACTATATCAAATAACTCAATTGTGGAGGAAGATGTAGTTGATTGTGTGGTATTGGACAACAAAACTGGTATCAAGAACTTCAAAACTTATGGTAACACCAATGATAGGTTCAGTCCTATTTCAGCAGATGCAACCCATTTTTCAAGTAATAACTCTGGAACTGACAAAAATATTTCTGAGGCTCCAGCTTCAGAAGCATCCTCTACTGTCACTGCAAGAATTGACAGACTAATTAATGAATTTGCTCAGTGTGGTTTAACAAAACTTCCAAAAAATGAAAAGAAGATTTTGTCATCTGTTGCCAGCAAAAAGAAGAAAAAATCTCGACAGCAAGCAATAAATTCCAGGTATCAAGATGGACAGCTTGCAACCAAAGGAATTCTTAATAAGAATGAGAGAATAAACACAAAAGGTAGAATTACAAAGGAAATGATAGTGCAAGATTCAGATAGTCCCCTTAAAGGAGGGATACTTTGTGAGGAAGACCTCCAGAAAAGTGATACTGTAATTGAATCAAATACTTTTTGTTCCAAAAGTAATCTCAATTCCACGATTTCCAAGAATTTCCATAGAAATAAATTAAATACTACTCAAAATTCCAAGGTTCAAGGACTTTTAACCAAAAGAAAATCTAGATCACTAAATAAAATAAGCTTAGGAGCACCTAAAAAAAGAGAAATCGGTCAAAGAGATAAAGTGTTTCCTCACAATGAATCTAAATATTGCAAAAGTACTTTTGAAAACAAAAGTTTATTTCATGTATTTAACATCCTTGAGCAAAAACCCAAAGATTTTTATGCACCGCAATCTCAAGCAGAAGTGGCATCTGGGTATTTGAGAGGAATGGCAAAGAAGAGTTTAGTTTCAAAAGTTACTGATTCACACATAACTTTAAAAAGCCAGAAAAAACGTAAAGGGGATAAAGTGAAAGCAAGTGCTATTTTAAGTAAACAACATGCTACAACCAGGGCAAATTCTTTAGCTTCTTTGAAAAAACCTGATTTTCCTGAGGCTATTGCTCATCATTCAATTCAAAATTATATACAGAGTTGGTTGCAGAACATAAATCCATATCCAACTTTAAAGCCTATAAAATCAGCTCCAGTATGTAGAAATGAAACGAGTGTGGTAAATTGTAGCAATAATAGTTTTTCAGGGAATGATCCCCATACAAATTCTGGAAAAATAAGTAATTTTGTTATGGAAAGTAATAAGCACATAACTAAAATTGCCGGTTTGACAGGAGATAATCTATGTAAAGAGGGAGATAAGTCTTTTATTGCCAATGACACTGGTGAAGAAGATCTCCATGAGACACAGGTTGGATCTCTGAATGATGCTTATTTGGTTCCCCTGCATGAACACTGTACTTTGTCACAGTCAGCTATTAATGATCATAATACTAAAAGTCATATAGCTGCTGAAAAATCAGGACCAGAGAAAAAACTTGTTTACCAGGAAATAAACCTAGCTAGAAAAAGGCAAAGTGTAGAGGCTGCCATTCAAGTAGATCCTATAGAAGAGGAAACTCCAAAAGACCTCTTACCAGTCCTGATGCTTCACCAATTGCAAGCTTCAGTTCCTGGTATTCACAAGACTCAGAATGGAGTTGTTCAAATGCCAGGTTCACTTGCAGGTGTTCCCTTTCATTCTGCAATATGTAATTCATCCACTAATCTCCTTCTAGCTTGGCTCTTGGTGCTAAACCTAAAGGGAAGTATGAATAGCTTCTGTCAAGTTGATGCTCACAAGGCTACCAACAAATCTTCAGAAACACTTGCATTGTTGGAGATTCTAAAGCACATAGCTATCACAGAGGAAGCTGATGACTTGAAAGCTGCTGTTGCCAATTTAGTGGAGTCAACTACAAGCCACTTTGGACTCAGTGAGAAAGAACAAGACATGGTTCCAATAGATCTTTCTGCAAATTGTTCCACGGTCAACATTCAGAGTGTTCCTAAGTGCAGTGAAAATGAAAGAACACAAGGAATCTCCTCTTTGGATGGAGGTTGCTCTGCCAGTGAGGCATGTGCCCCTGAAGTCTGTGTTTTGGAAGTGACTTGCTCTCCATGTGAGATGTGCACTGTAAATAAGGCTTATTCTCCAAAAGAGACATGTAACCCCAGTGACACTTTTTTTCCTAGTGATGGTTATGGTGTGGATCAGACTTCTATGAATAAGGCTTGTTTCCTAGGAGAGGTCTGTTCACTTACTGATACTGTGTTTTCTGATAAGGCTTGTGCTCAAAAGGAGAACCATACCTATGAGGGAGCTTGCCCAATTGATGAGACCTACGTTCCTGTCAATGTCTGCAATACCATTGACTTTTTAAACTCCAAAGAAAACACATATACTGATAACTTGGATTCAACTGAAGAGTTAGAAAGAGGTGATGACATTCAGAAAGATCTAAATATTTTGACAGACCCTGAATATAAAAATGGATTTAATACATTGGTGTCACATCAAAATGTCAGTAATTTAAGCTCCTGTGGCCTTTGCCTAAGTGAAAAAGAAGCAGAACTTGATAAGAAACATAGTTCTCTAGATGATTTTGAAAATTGTTCACTAAGGAAGTTTCAGGATGAAAATGCATATACTTCCTTTGATATGGAAGAACCACGGACTTCTGAAGAACCAGGCTCAATAACCAACAGCATGACATCAAGTGAAAGAAACATTTCAGAATTGGAATCTTTTGAAGAATTAGAAAACCATGACACTGATATCTTTAATACAGTGGTAAATGGAGGAGAGCAAGCCACTGAAGAATTAATCCAAGAAGAGGTAGAGGCTAGTAAAACTTTAGAATTGATAGACATCTCTAGTAAGAATATTATGGAAGAAAAAAGAATGAACGGTATAATTTATGAAATAATCAGTAAGAGGCTGGCAACACCACCATCTTTAGATTTTTGCTATGATTCTAAGCAAAATAGTGAAAAGGAGACCAATGAAGGAGAAACTAAGATGGTAAAAATGATGGTGAAAACTATGGAAACTGGAAGTTATTCAGAGTCCTCTCCTGATTTAAAAAAATGCATCAAAAGTCCAGTGACTTCTGATTGGTCAGACTATCGGCCTGACAGTGACAGTGAGCAGCCATATAAAACATCCAGTGATGATCCCAATGACAGTGGCGAACTTACCCAAGAGAAAGAATATAACATAGGATTTGTTAAAAGGGCAATAGAAAAACTGTACGGTAAAGCAGATATTATCAAACCATCTTTTTTTCCTGGGTCTACCCGCAAATCTCAGGTTTGTCCTTATAATTCTGTGGAATTTCAGTGTTCCAGGAAAGCAAGTCTTTATGATTCTGAAGGGCAGTCATTTGGCTCTTCTGAACAGGTATCTAGTAGTTCATCTATGTTGCAGGAATTCCAGGAGGAAAGACAAGATAAGTGTGATGTTAGTGCTGTGAGGGACAATTATTGTAGGGGTGACATTGTAGAACCTGGTACAAAACAAAATGATGATAGCAGAATCCTCACAGACATAGAGGAAGGAGTACTGATTGACAAAGGCAAATGGCTTCTGAAAGAAAATCATTTGCTAAGGATGTCATCTGAAAATCCTGGCATGTGTGGCAATGCAGACACCACATCAGTGGACACCCTACTTGATAATAACAGCAGTGAGGTACCATATTCACATTTTGGTAATTTGGCCCCAGGCCCAACGATGGATGAACTCTCCTCTTCAGAACTCGAGGAACTGACTCAACCCCTTGAACTAAAATGCAATTACTTTAACATGCCTCATGGTAGTGACTCAGAACCTTTTCATGAGGACTTGCTGGATGTTCGCAATGAAACCTGTGCCAAGGAAAGAATAGCAAATCATCATACAGAGGAGAAGGGTAGTCATCAGTCAGAAAGAGTATGCACATCTGTCACTCATTCCTTTATTTCTGCTGGTAACAAAGTCTACCCTGTCTCTGATGATGCTATTAAAAACCAACCATTGCCTGGCAGTAATATGATTCATGGTACACTTCAGGAAGCTGACTCTTTGGATAAACTGTATGCTCTTTGTGGTCAACATTGCCCAATACTAACTGTTATTATCCAACCCATGAATGAGGAAGACCGAGGATTTGCATATCGCAAAGAATCTGATATTGAAAATTTCTTGGGTTTTTATTTATGGATGAAAATACACCCATATTTACTTCAGACAGACAAAAATGTGTTCAGGGAAGAGAACAATAAAGCAAGTATGAGACAAAATCTTATTGATAATGCCATTGGTGATATATTTGATCAGTTTTATTTCAGTAACACATTTGACTTGATGGGTAAAAGAAGAAAACAAAAAAGAATTAACTTCTTGGGGTTAGAGGAAGAAGGTAATTTAAAGAAATTTCAACCAGATTTGAAGGAAAGGTTTTGTATGAATTTCTTGCACACATCATTGTTAGTTGTGGGTAATGTGGATTCAAATACACAAGACCTCAGCGGTCAGACAAATGAAATCTTTAAAGCAGTCGATGAGAATAACAACTTATTAAATAACAGATTCCAGGGCTCAAGAACAAATCTCAACCAAGTAGTAAGAGAAAATATCAACTGTCATTACTTCTTTGAAATGCTTGGTCAAGCTTGCCTCTTAGATATTTGCCAAGTTGAGACCTCCTTAAATATTAGCAACAGAAATATTTTAGAACTTTGTATGTTTGAGGGTGAAAATCTTTTCATTTGGGAAGAGGAAGACATATTAAATTTAACTGATCTTGAAAGCAGTAGAGAACAAGAAGATTTATAA

Back to List