Details for gene: RPE65


oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen : Catalysis of an oxidation-reduction (redox) reaction in which hydrogen or electrons are transferred from one donor, and two oxygen atoms is incorporated into a donor. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; isomerase activity : Catalysis of the geometric or structural changes within one molecule. Isomerase is the systematic name for any enzyme of EC class 5. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; endoplasmic reticulum membrane : The lipid bilayer surrounding the endoplasmic reticulum. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; intracellular membrane-bounded organelle : Organized structure of distinctive morphology and function, bounded by a single or double lipid bilayer membrane and occurring within the cell. Includes the nucleus, mitochondria, plastids, vacuoles, and vesicles. Excludes the plasma membrane. ; hydrolase activity : Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3. ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; retinoid metabolic process : The chemical reactions and pathways involving retinoids, any member of a class of isoprenoids that contain or are derived from four prenyl groups linked head-to-tail. Retinoids include retinol and retinal and structurally similar natural derivatives or synthetic compounds, but need not have vitamin A activity. ; retina homeostasis : A tissue homeostatic process involved in the maintenance of an internal equilibrium within the retina of the eye, including control of cellular proliferation and death and control of metabolic function. ; detection of light stimulus involved in visual perception : The series of events involved in visual perception in which a light stimulus is received and converted into a molecular signal. ; vitamin A metabolic process : The chemical reactions and pathways involving any of the vitamin A compounds, retinol, retinal (retinaldehyde) and retinoic acid, all of which are derivatives of beta-carotene. ; phosphatidylserine binding : Interacting selectively and non-covalently with phosphatidylserine, a class of glycophospholipids in which a phosphatidyl group is esterified to the hydroxyl group of L-serine. ; retinal isomerase activity : Catalysis of the reaction: all-trans-retinal = 11-cis-retinal. ; phosphatidylcholine binding : Interacting selectively and non-covalently with phosphatidylcholine, a class of glycophospholipids in which a phosphatidyl group is esterified to the hydroxyl group of choline. ; retinol isomerase activity : Catalysis of the reaction: all-trans-retinol = 11-cis-retinol. ; all-trans-retinyl-palmitate hydrolase, 11-cis retinol forming activity : Catalysis of the reaction: H(2)O + all-trans-retinyl palmitate = 11-cis-retinol + H(+) + palmitate. ; all-trans-retinyl-ester hydrolase, 11-cis retinol forming activity : Catalysis of the reaction: H(2)O + all-trans-retinyl ester = 11-cis-retinol + fatty acid. ; cardiolipin binding : Interacting selectively and non-covalently with cardiolipin. ; neural retina development : The progression of the neural retina over time from its initial formation to the mature structure. The neural retina is the part of the retina that contains neurons and photoreceptor cells. ; circadian rhythm : Any biological process in an organism that recurs with a regularity of approximately 24 hours. ; insulin receptor signaling pathway : The series of molecular signals generated as a consequence of the insulin receptor binding to insulin. ; response to light stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a light stimulus, electromagnetic radiation of wavelengths classified as infrared, visible or ultraviolet light. ; regulation of gene expression : Any process that modulates the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form. ; retinol metabolic process : The chemical reactions and pathways involving retinol, one of the three compounds that makes up vitamin A. ; retinal metabolic process : The chemical reactions and pathways involving retinal, a compound that plays an important role in the visual process in most vertebrates. In the retina, retinal combines with opsins to form visual pigments. Retinal is one of the forms of vitamin A. ; camera-type eye development : The process whose specific outcome is the progression of the camera-type eye over time, from its formation to the mature structure. The camera-type eye is an organ of sight that receives light through an aperture and focuses it through a lens, projecting it on a photoreceptor field. ; retina development in camera-type eye : The process whose specific outcome is the progression of the retina over time, from its formation to the mature structure. The retina is the innermost layer or coating at the back of the eyeball, which is sensitive to light and in which the optic nerve terminates. ; retina morphogenesis in camera-type eye : The process in which the anatomical structure of the retina is generated and organized. ; cellular response to electrical stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an electrical stimulus. ; zeaxanthin biosynthetic process : The chemical reactions and pathways resulting in the formation of zeaxanthin. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cell body : The portion of a cell bearing surface projections such as axons, dendrites, cilia, or flagella that includes the nucleus, but excludes all cell projections. ;


Symbol
RPE65
Name
retinoid isomerohydrolase RPE65
Entrez ID
6121
Ensembl ID
ENSG00000116745    (more details)
KEGG ID
hsa:6121    (more details)
OMIM ID
180069
Uniprot ID
Q16518  
GO ID
hsa:6121    (more details)
Chromosome
16
Strand
-1
Start
54930865
End
54934485
miRNA Interactions
hsa-miR-107 (RPM: 234.4574) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-32-5p (RPM: 14.5562) / hsa-miR-335-5p (RPM: 265.7294) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Retinol metabolism /
Sequence
ATGTCTATCCAGGTTGAGCATCCTGCTGGTGGTTACAAGAAACTGTTTGAAACTGTGGAGGAACTGTCCTCGCCGCTCACAGCTCATGTAACAGGCAGGATCCCCCTCTGGCTCACCGGCAGTCTCCTTCGATGTGGGCCAGGACTCTTTGAAGTTGGATCTGAGCCATTTTACCACCTGTTTGATGGGCAAGCCCTCCTGCACAAGTTTGACTTTAAAGAAGGACATGTCACATACCACAGAAGGTTCATCCGCACTGATGCTTACGTACGGGCAATGACTGAGAAAAGGATCGTCATAACAGAATTTGGCACCTGTGCTTTCCCAGATCCCTGCAAGAATATATTTTCCAGGTTTTTTTCTTACTTTCGAGGAGTAGAGGTTACTGACAATGCCCTTGTTAATGTCTACCCAGTGGGGGAAGATTACTACGCTTGCACAGAGACCAACTTTATTACAAAGATTAATCCAGAGACCTTGGAGACAATTAAGCAGGTTGATCTTTGCAACTATGTCTCTGTCAATGGGGCCACTGCTCACCCCCACATTGAAAATGATGGAACCGTTTACAATATTGGTAATTGCTTTGGAAAAAATTTTTCAATTGCCTACAACATTGTAAAGATCCCACCACTGCAAGCAGACAAGGAAGATCCAATAAGCAAGTCAGAGATCGTTGTACAATTCCCCTGCAGTGACCGATTCAAGCCATCTTACGTTCATAGTTTTGGTCTGACTCCCAACTATATCGTTTTTGTGGAGACACCAGTCAAAATTAACCTGTTCAAGTTCCTTTCTTCATGGAGTCTTTGGGGAGCCAACTACATGGATTGTTTTGAGTCCAATGAAACCATGGGGGTTTGGCTTCATATTGCTGACAAAAAAAGGAAAAAGTACCTCAATAATAAATACAGAACTTCTCCTTTCAACCTCTTCCATCACATCAACACCTATGAAGACAATGGGTTTCTGATTGTGGATCTCTGCTGCTGGAAAGGATTTGAGTTTGTTTATAATTACTTATATTTAGCCAATTTACGTGAGAACTGGGAAGAGGTGAAAAAAAATGCCAGAAAGGCTCCCCAACCTGAAGTTAGGAGATATGTACTTCCTTTGAATATTGACAAGGCTGACACAGGCAAGAATTTAGTCACGCTCCCCAATACAACTGCCACTGCAATTCTGTGCAGTGACGAGACTATCTGGCTGGAGCCTGAAGTTCTCTTTTCAGGGCCTCGTCAAGCATTTGAGTTTCCTCAAATCAATTACCAGAAGTATTGTGGGAAACCTTACACATATGCGTATGGACTTGGCTTGAATCACTTTGTTCCAGATAGGCTCTGTAAGCTGAATGTCAAAACTAAAGAAACTTGGGTTTGGCAAGAGCCTGATTCATACCCATCAGAACCCATCTTTGTTTCTCACCCAGATGCCTTGGAAGAAGATGATGGTGTAGTTCTGAGTGTGGTGGTGAGCCCAGGAGCAGGACAAAAGCCTGCTTATCTCCTGATTCTGAATGCCAAGGACTTAAGTGAAGTTGCCCGGGCTGAAGTGGAGATTAACATCCCTGTCACCTTTCATGGACTGTTCAAAAAATCTTGA

Back to List