Details for gene: SAG


signal transduction : The cellular process in which a signal is conveyed to trigger a change in the activity or state of a cell. Signal transduction begins with reception of a signal (e.g. a ligand binding to a receptor or receptor activation by a stimulus such as light), or for signal transduction in the absence of ligand, signal-withdrawal or the activity of a constitutively active receptor. Signal transduction ends with regulation of a downstream cellular process, e.g. regulation of transcription or regulation of a metabolic process. Signal transduction covers signaling from receptors located on the surface of the cell and signaling via molecules located within the cell. For signaling between cells, signal transduction is restricted to events at and within the receiving cell. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; regulation of catalytic activity : Any process that modulates the activity of an enzyme. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; photoreceptor inner segment : The inner segment of a vertebrate photoreceptor containing mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; G protein-coupled receptor binding : Interacting selectively and non-covalently with a G protein-coupled receptor. ; cell surface receptor signaling pathway : A series of molecular signals initiated by activation of a receptor on the surface of a cell. The pathway begins with binding of an extracellular ligand to a cell surface receptor, or for receptors that signal in the absence of a ligand, by ligand-withdrawal or the activity of a constitutively active receptor. The pathway ends with regulation of a downstream cellular process, e.g. transcription. ; rhodopsin mediated signaling pathway : The series of molecular signals generated as a consequence of excitation of rhodopsin by a photon and the events that convert the absorbed photons into a cellular response. ; opsin binding : Interacting selectively and non-covalently with an opsin, any of a group of hydrophobic, integral membrane glycoproteins located primarily in the disc membrane of rods or cones, involved in photoreception. ; protein phosphatase inhibitor activity : Binds to and stops, prevents or reduces the activity of a protein phosphatase, an enzyme that hydrolyzes phosphate groups from phosphorylated proteins. ; phosphoprotein binding : Interacting selectively and non-covalently with a phosphorylated protein. ; G protein-coupled receptor internalization : The process that results in the uptake of a G protein-coupled receptor into an endocytic vesicle. ;


Symbol
SAG
Name
S-antigen visual arrestin
Entrez ID
6295
Ensembl ID
ENSG00000130561    (more details)
KEGG ID
hsa:6295    (more details)
OMIM ID
181031
Uniprot ID
P10523  
GO ID
hsa:6295    (more details)
Chromosome
4
Strand
1
Start
154626945
End
154753120
miRNA Interactions
hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-335-5p (RPM: 265.7294) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Activation of the phototransduction cascade / Inactivation, recovery and regulation of the phototransduction cascade /
Sequence
ATGGCAGCCAGCGGGAAGACCAGCAAGTCCGAACCGAACCATGTTATCTTCAAGAAGATCTCCCGGGACAAATCGGTGACCATCTACCTGGGGAACAGAGACTACATAGACCATGTCAGCCAAGTCCAGCCTGTGGATGGTGTCGTGTTGGTTGATCCTGATCTTGTGAAGGGAAAGAAAGTGTATGTCACTCTGACCTGCGCCTTCCGCTATGGCCAAGAGGACATTGACGTGATCGGCTTGACCTTCCGCAGGGACCTGTACTTCTCCCGGGTCCAGGTGTATCCTCCTGTGGGGGCCGCGAGCACCCCCACAAAACTGCAAGAGAGCCTGCTTAAAAAGCTGGGGAGCAACACGTACCCCTTTCTCCTGACGTTTCCTGACTACTTGCCCTGTTCAGTGATGTTGCAGCCAGCTCCACAAGATTCAGGGAAGTCCTGTGGGGTTGACTTTGAGGTCAAAGCATTCGCCACAGACAGCACCGATGCCGAAGAGGACAAAATCCCCAAGAAGAGCTCCGTGCGATTACTGATCCGCAAAGTACAGCATGCCCCACTTGAGATGGGTCCCCAGCCCCGAGCTGAGGCGGCCTGGCAGTTCTTCATGTCTGACAAGCCCCTGCACCTTGCGGTCTCTCTCAACAAAGAGATCTATTTCCATGGGGAGCCCATCCCTGTGACCGTGACTGTCACCAATAACACAGAGAAGACCGTGAAGAAGATTAAAGCATTCGTGGAACAGGTGGCCAATGTGGTTCTCTACTCGAGTGATTATTACGTCAAGCCCGTGGCTATGGAGGAAGCGCAAGAAAAAGTGCCACCAAACAGCACTTTGACCAAGACGCTGACGCTGCTGCCCTTGCTGGCTAACAATCGAGAAAGGAGAGGCATTGCCCTGGATGGGAAAATCAAGCACGAGGACACAAACCTTGCCTCCAGCACCATCATTAAGGAGGGCATAGACCGGACCGTCCTGGGAATCCTGGTGTCTTACCAGATCAAGGTGAAGCTCACAGTGTCAGGCTTTCTGGGAGAGCTCACCTCCAGTGAAGTCGCCACTGAGGTCCCATTCCGCCTCATGCACCCTCAGCCTGAGGACCCAGCTAAGGAAAGTTATCAGGATGCAAATTTAGTTTTTGAGGAGTTTGCTCGCCATAATCTGAAAGATGCAGGAGAAGCTGAGGAGGGGAAGAGAGACAAGAATGACGTTGATGAGTGA

Back to List