Details for gene: TUB


extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; phagocytosis : A vesicle-mediated transport process that results in the engulfment of external particulate material by phagocytes and their delivery to the lysosome. The particles are initially contained within phagocytic vacuoles (phagosomes), which then fuse with primary lysosomes to effect digestion of the particles. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; positive regulation of phagocytosis : Any process that activates or increases the frequency, rate or extent of phagocytosis. ; protein localization to cilium : A process in which a protein is transported to, or maintained in, a location within a cilium. ; protein-containing complex binding : Interacting selectively and non-covalently with a macromolecular complex. ; G protein-coupled receptor binding : Interacting selectively and non-covalently with a G protein-coupled receptor. ; intraciliary transport particle A binding : Interacting selectively and non-covalently with an intraciliary transport particle A (IFT A) complex. ; intraciliary transport : The bidirectional movement of large protein complexes along microtubules within a cilium, mediated by motor proteins. ; phagocytosis, recognition : The initial step in phagocytosis involving adhesion to bacteria, immune complexes and other particulate matter, or an apoptotic cell and based on recognition of factors such as bacterial cell wall components, opsonins like complement and antibody or protein receptors and lipids like phosphatidyl serine, and leading to intracellular signaling in the phagocytosing cell. ; sensory perception of sound : The series of events required for an organism to receive an auditory stimulus, convert it to a molecular signal, and recognize and characterize the signal. Sonic stimuli are detected in the form of vibrations and are processed to form a sound. ; regulation of G protein-coupled receptor signaling pathway : Any process that modulates the frequency, rate or extent of G protein-coupled receptor signaling pathway. ; photoreceptor cell maintenance : Any process preventing the degeneration of the photoreceptor, a specialized cell type that is sensitive to light. ; retina development in camera-type eye : The process whose specific outcome is the progression of the retina over time, from its formation to the mature structure. The retina is the innermost layer or coating at the back of the eyeball, which is sensitive to light and in which the optic nerve terminates. ; receptor localization to non-motile cilium : A process in which a receptor is transported to, or maintained in, a location within a non-motile cilium. ; protein localization to photoreceptor outer segment : A process in which a protein is transported to, or maintained in, a location within a photoreceptor outer segment. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ;


Symbol
TUB
Name
TUB bipartite transcription factor
Entrez ID
7275
Ensembl ID
ENSG00000166402    (more details)
KEGG ID
hsa:7275    (more details)
OMIM ID
601197
Uniprot ID
P50607  
GO ID
hsa:7275    (more details)
Chromosome
11
Strand
1
Start
65044818
End
65058553
miRNA Interactions
hsa-miR-29b-3p (RPM: 118.8178) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-29a-3p (RPM: 1246.9046) / hsa-miR-423-5p (RPM: 976.289) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-340-5p (RPM: 285.763) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-135b-5p (RPM: 25.9152) / hsa-miR-1297 (RPM: 0.0024) / hsa-miR-4775 (RPM: 1.173) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-338-3p (RPM: 158.4942) / hsa-miR-19b-3p (RPM: 197.0578) / hsa-miR-19a-3p (RPM: 25.4064) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-138-5p (RPM: 67.2828) / hsa-miR-92b-3p (RPM: 8345.0264) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-18b-3p (RPM: 0.2006) / hsa-miR-579-3p (RPM: 0.0084) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-548o-3p (RPM: 3.2198) / hsa-miR-130b-3p (RPM: 68.2014) / hsa-miR-588 (RPM: 0.0032) / hsa-miR-221-3p (RPM: 758.7978) / hsa-miR-128-3p (RPM: 329.321) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-32-5p (RPM: 14.5562) / hsa-miR-484 (RPM: 434.5276) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-326 (RPM: 10.9272) / hsa-miR-766-3p (RPM: 5.2956) / hsa-miR-181c-5p (RPM: 1285.07) / hsa-miR-616-5p (RPM: 3.0294) / hsa-miR-185-5p (RPM: 29.191) / hsa-miR-940 (RPM: 4.614) / hsa-miR-320b (RPM: 35.0146) / hsa-let-7f-2-3p (RPM: 13.1322) / hsa-miR-196b-5p (RPM: 0.2478) / hsa-miR-653-5p (RPM: 3.9202) / hsa-miR-641 (RPM: 12.2284) / hsa-miR-25-3p (RPM: 1063.0626) / hsa-miR-146b-3p (RPM: 16.408) / hsa-miR-676-3p (RPM: 0.9734) / hsa-miR-1915-5p (RPM: 0.0172) / hsa-miR-222-3p (RPM: 1699.0194) / hsa-miR-31-5p (RPM: 310.1326) / hsa-miR-3177-5p (RPM: 0.1208) / hsa-miR-708-5p (RPM: 69.2328) / hsa-miR-744-3p (RPM: 3.4814) / hsa-miR-505-5p (RPM: 1.7508) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-330-3p (RPM: 21.3424) / hsa-miR-3158-3p (RPM: 13.2892) / hsa-miR-28-5p (RPM: 190.0872) / hsa-miR-744-5p (RPM: 290.9362) / hsa-miR-501-3p (RPM: 166.2736) / hsa-miR-181a-2-3p (RPM: 1451.5764) / hsa-miR-504-5p (RPM: 27.4444) / hsa-miR-377-5p (RPM: 8.4706) / hsa-miR-320e (RPM: 0.223) / hsa-miR-4473 (RPM: 0.2418) / hsa-miR-3200-3p (RPM: 32.0156) / hsa-miR-1179 (RPM: 0.9322) / hsa-miR-99b-3p (RPM: 43.962) / hsa-miR-296-5p (RPM: 12.5874) / hsa-miR-374c-3p (RPM: 0.0156) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-339-3p (RPM: 185.7798) / hsa-miR-99a-3p (RPM: 26.3048) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-10a-5p (RPM: 408.7974) / hsa-let-7i-3p (RPM: 13.1326) / hsa-miR-652-3p (RPM: 178.199) / hsa-miR-6867-5p (RPM: 0.0198) / hsa-miR-511-3p (RPM: 0.1802) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGACTTCCAAGCCGCATTCCGACTGGATTCCCTACAGTGTCTTAGATGATGAGGGCAGAAACCTGAGGCAGCAGAAGCTTGATCGGCAGCGGGCCCTGCTGGAGCAGAAGCAGAAGAAGAAGCGCCAGGAGCCCCTGATGGTGCAGGCCAATGCAGATGGGCGGCCCCGGAGCCGGCGGGCCCGGCAGTCAGAGGAACAAGCCCCCCTGGTGGAGTCCTACCTCAGCAGCAGTGGCAGCACCAGCTACCAAGTTCAAGAGGCCGACTCACTCGCCAGTGTGCAGCTGGGAGCCACGCGCCCAACAGCACCAGCTTCAGCCAAGAGAACCAAGGCGGCAGCTACAGCAGGGGGCCAGGGTGGCGCCGCTAGGAAGGAGAAGAAGGGAAAGCACAAAGGCACCAGCGGGCCAGCAGCACTGGCAGAAGACAAGTCTGAGGCCCAAGGCCCAGTGCAGATTCTGACTGTGGGCCAGTCAGACCACGCCCAGGACGCAGGGGAGACGGCAGCTGGTGGGGGCGAACGGCCCAGCGGGCAGGATCTCCGTGCCACGATGCAGAGGAAGGGCATCTCCAGCAGCATGAGCTTTGACGAGGATGAGGAGGATGAGGAGGAGAATAGCTCCAGCTCCTCCCAGCTAAATAGTAACACCCGCCCCAGCTCTGCTACTAGCAGGAAGTCCGTCAGGGAGGCAGCCTCAGCCCCTAGCCCAACAGCTCCAGAGCAACCAGTGGACGTTGAGGTCCAGGATCTTGAGGAGTTTGCACTGAGGCCGGCCCCCCAGGGTATCACCATCAAATGCCGCATCACTCGGGACAAGAAAGGGATGGACCGGGGCATGTACCCCACCTACTTTCTGCACCTGGACCGTGAGGATGGGAAGAAGGTGTTCCTCCTGGCGGGAAGGAAGAGAAAGAAGAGTAAAACTTCCAATTACCTCATCTCTGTGGACCCAACAGACTTGTCTCGAGGAGGGGACAGCTATATCGGGAAACTGCGGTCCAACTTGATGGGCACCAAGTTCACTGTTTATGACAATGGAGTCAACCCTCAGAAGGCCTCATCCTCCACTTTGGAAAGTGGAACCTTACGTCAGGAGCTGGCAGCTGTGTGCTACGAGACAAACGTCTTAGGCTTCAAGGGGCCTCGGAAGATGAGCGTGATTGTCCCAGGCATGAACATGGTTCATGAGAGAGTCTCTATCCGCCCCCGCAACGAGCATGAGACACTGCTAGCACGCTGGCAGAATAAGAACACGGAGAGTATCATCGAGCTGCAAAACAAGACACCTGTCTGGAATGATGACACACAGTCCTATGTACTCAACTTCCATGGGCGCGTCACACAGGCCTCCGTGAAGAACTTCCAGATCATCCATGGCAATGACCCGGACTACATCGTGATGCAGTTTGGCCGGGTAGCAGAGGATGTGTTCACCATGGATTACAACTACCCGCTGTGTGCACTGCAGGCCTTTGCCATTGCCCTGTCCAGCTTCGACAGCAAGCTGGCGTGCGAGTAG

Back to List