Details for gene: CLRN1


membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; sensory perception of sound : The series of events required for an organism to receive an auditory stimulus, convert it to a molecular signal, and recognize and characterize the signal. Sonic stimuli are detected in the form of vibrations and are processed to form a sound. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; microvillus : Thin cylindrical membrane-covered projections on the surface of an animal cell containing a core bundle of actin filaments. Present in especially large numbers on the absorptive surface of intestinal cells. ; equilibrioception : The series of events required for an organism to receive an orientational stimulus, convert it to a molecular signal, and recognize and characterize the signal. Equilibrioception refers to a combination of processes by which an organism can perceive its orientation with respect to gravity. In animals, stimuli come from labyrinth system of the inner ears, monitoring the direction of motion; visual stimuli, with information on orientation and motion; pressure receptors, which tell the organism which body surfaces are in contact with the ground; and proprioceptive cues, which report which parts of the body are in motion. ; lamellipodium : A thin sheetlike process extended by the leading edge of a migrating cell or extending cell process; contains a dense meshwork of actin filaments. ; photoreceptor cell maintenance : Any process preventing the degeneration of the photoreceptor, a specialized cell type that is sensitive to light. ; sensory perception of light stimulus : The series of events required for an organism to receive a sensory light stimulus, convert it to a molecular signal, and recognize and characterize the signal. This is a neurological process. ; actin filament organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of cytoskeletal structures comprising actin filaments. Includes processes that control the spatial distribution of actin filaments, such as organizing filaments into meshworks, bundles, or other structures, as by cross-linking. ; positive regulation of lamellipodium assembly : Any process that increases the rate, frequency or extent of the formation of a lamellipodium, a thin sheetlike extension of the surface of a migrating cell. ; cell motility : Any process involved in the controlled self-propelled movement of a cell that results in translocation of the cell from one place to another. ; neuromuscular process controlling balance : Any process that an organism uses to control its balance, the orientation of the organism (or the head of the organism) in relation to the source of gravity. In humans and animals, balance is perceived through visual cues, the labyrinth system of the inner ears and information from skin pressure receptors and muscle and joint receptors. ; auditory receptor cell stereocilium organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a stereocilium. A stereocilium is an actin-based protrusion from the apical surface of auditory hair cells. ; auditory receptor cell development : The process whose specific outcome is the progression of an auditory receptor cell over time, from its formation to the mature structure. Cell development does not include the steps involved in committing a cell to a specific fate. ; microtubule cytoskeleton : The part of the cytoskeleton (the internal framework of a cell) composed of microtubules and associated proteins. ; trans-Golgi network transport vesicle : A vesicle that mediates transport between the trans-Golgi network and other parts of the cell. ; stereocilium : An actin-based protrusion from the apical surface of auditory and vestibular hair cells and of neuromast cells. These protrusions are supported by a bundle of cross-linked actin filaments (an actin cable), oriented such that the plus (barbed) ends are at the tip of the protrusion, capped by a tip complex which bridges to the plasma. Bundles of stereocilia act as mechanosensory organelles. ; basal part of cell : The region of a cell situated near the base. For example, in a polarized epithelial cell, the basal surface rests on the basal lamina that separates the epithelium from other tissue. ;


Symbol
CLRN1
Name
clarin 1
Entrez ID
7401
Ensembl ID
ENSG00000163646    (more details)
KEGG ID
hsa:7401    (more details)
OMIM ID
268000
Uniprot ID
P58418  
GO ID
hsa:7401    (more details)
Chromosome
7
Strand
-1
Start
99392048
End
99408597
miRNA Interactions
hsa-miR-126-3p (RPM: 494.5936) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGCCAAGCCAACAGAAGAAAATCATTTTTTGCATGGCCGGAGTGTTCAGTTTTGCATGTGCCCTCGGAGTTGTGACAGCCTTGGGGACACCGTTGTGGATCAAAGCCACTGTCCTCTGCAAAACGGGAGCTCTGCTCGTCAATGCCTCAGGGCAGGAGCTGGACAAGTTTATGGGTGAAATGCAGTACGGGCTTTTCCACGGAGAGGGTGTGAGGCAGTGTGGGTTGGGAGCAAGGCCCTTTCGGTTCTCATTTTTTCCAGATTTGCTCAAAGCAATCCCAGTGAGCATCCACGTCAATGTCATTCTCTTCTCTGCCATCCTTATTGTGTTAACCATGGTGGGGACAGCCTTCTTCATGTACAATGCTTTTGGAAAACCTTTTGAAACTCTGCATGGTCCCCTAGGGCTGTACCTTTTGAGCTTCATTTCAGGCTCCTGTGGCTGTCTTGTCATGATATTGTTTGCCTCTGAAGTGAAAATCCATCACCTCTCAGAAAAAATTGCAAATTATAAAGAAGGGACTTATGTCTACAAAACGCAAAGTGAAAAATATACCACCTCATTCTGGGTCATTTTCTTTTGCTTTTTTGTTCATTTTCTGAATGGGCTCCTAATACGACTTGCTGGATTTCAGTTCCCTTTTGCAAAATCTAAAGACGCAGAAACAACTAATGTAGCTGCAGATCTAATGTACTGA

Back to List