Details for gene: BEST1


chloride channel activity : Enables the facilitated diffusion of a chloride (by an energy-independent process) involving passage through a transmembrane aqueous pore or channel without evidence for a carrier-mediated mechanism. ; chloride transmembrane transport : The process in which chloride is transported across a membrane. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; ion transport : The directed movement of charged atoms or small charged molecules into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; basolateral plasma membrane : The region of the plasma membrane that includes the basal end and sides of the cell. Often used in reference to animal polarized epithelial membranes, where the basal membrane is the part attached to the extracellular matrix, or in plant cells, where the basal membrane is defined with respect to the zygotic axis. ; chloride transport : The directed movement of chloride into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; bicarbonate transport : The directed movement of bicarbonate into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; chloride channel complex : An ion channel complex through which chloride ions pass. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; intracellular calcium activated chloride channel activity : Enables the transmembrane transfer of chloride by a channel that opens in response to stimulus by a calcium ion or ions. Transport by a channel involves catalysis of facilitated diffusion of a solute (by an energy-independent process) involving passage through a transmembrane aqueous pore or channel, without evidence for a carrier-mediated mechanism. ; ion transmembrane transport : A process in which an ion is transported across a membrane. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; bicarbonate transmembrane transporter activity : Enables the transfer of bicarbonate from one side of a membrane to the other. Bicarbonate is the hydrogencarbonate ion, HCO3-. ; transepithelial chloride transport : The directed movement of chloride ions from one side of an epithelium to the other. ; detection of light stimulus involved in visual perception : The series of events involved in visual perception in which a light stimulus is received and converted into a molecular signal. ; regulation of calcium ion transport : Any process that modulates the frequency, rate or extent of the directed movement of calcium ions into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; basal plasma membrane : The region of the plasma membrane located at the basal end of the cell. Often used in reference to animal polarized epithelial membranes, where the basal membrane is the part attached to the extracellular matrix, or in plant cells, where the basal membrane is defined with respect to the zygotic axis. ;


Symbol
BEST1
Name
bestrophin 1
Entrez ID
7439
Ensembl ID
ENSG00000167995    (more details)
KEGG ID
hsa:7439    (more details)
OMIM ID
153700
Uniprot ID
O76090  
GO ID
hsa:7439    (more details)
Chromosome
4
Strand
1
Start
625573
End
670782
miRNA Interactions
hsa-miR-132-3p (RPM: 82.2598) / hsa-miR-144-3p (RPM: 6.9904) / hsa-miR-191-5p (RPM: 12993.8088) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Stimuli-sensing channels /
Sequence
ATGACCATCACTTACACAAGCCAAGTGGCTAATGCCCGCTTAGGCTCCTTCTCCCGCCTGCTGCTGTGCTGGCGGGGCAGCATCTACAAGCTGCTATATGGCGAGTTCTTAATCTTCCTGCTCTGCTACTACATCATCCGCTTTATTTATAGGCTGGCCCTCACGGAAGAACAACAGCTGATGTTTGAGAAACTGACTCTGTATTGCGACAGCTACATCCAGCTCATCCCCATTTCCTTCGTGCTGGGCTTCTACGTGACGCTGGTCGTGACCCGCTGGTGGAACCAGTACGAGAACCTGCCGTGGCCCGACCGCCTCATGAGCCTGGTGTCGGGCTTCGTCGAAGGCAAGGACGAGCAAGGCCGGCTGCTGCGGCGCACGCTCATCCGCTACGCCAACCTGGGCAACGTGCTCATCCTGCGCAGCGTCAGCACCGCAGTCTACAAGCGCTTCCCCAGCGCCCAGCACCTGGTGCAAGCAGGCTTTATGACTCCGGCAGAACACAAGCAGTTGGAGAAACTGAGCCTACCACACAACATGTTCTGGGTGCCCTGGGTGTGGTTTGCCAACCTGTCAATGAAGGCGTGGCTTGGAGGTCGAATCCGGGACCCTATCCTGCTCCAGAGCCTGCTGAACGAGATGAACACCTTGCGTACTCAGTGTGGACACCTGTATGCCTACGACTGGATTAGTATCCCACTGGTGTATACACAGGTGGTGACTGTGGCGGTGTACAGCTTCTTCCTGACTTGTCTAGTTGGGCGGCAGTTTCTGAACCCAGCCAAGGCCTACCCTGGCCATGAGCTGGACCTCGTTGTGCCCGTCTTCACGTTCCTGCAGTTCTTCTTCTATGTTGGCTGGCTGAAGGTGGCAGAGCAGCTCATCAACCCCTTTGGAGAGGATGATGATGATTTTGAGACCAACTGGATTGTCGACAGGAATTTGCAGGTGTCCCTGTTGGCTGTGGATGAGATGCACCAGGACCTGCCTCGGATGGAGCCGGACATGTACTGGAATAAGCCCGAGCCACAGCCCCCCTACACAGCTGCTTCCGCCCAGTTCCGTCGAGCCTCCTTTATGGGCTCCACCTTCAACATCAGCCTGAACAAAGAGGAGATGGAGTTCCAGCCCAATCAGGAGGACGAGGAGGATGCTCACGCTGGCATCATTGGCCGCTTCCTAGGCCTGCAGTCCCATGATCACCATCCTCCCAGGGCAAACTCAAGGACCAAACTACTGTGGCCCAAGAGGGAATCCCTTCTCCACGAGGGCCTGCCCAAAAACCACAAGGCAGCCAAACAGAACGTTAGGGGCCAGGAAGACAACAAGGCCTGGAAGCTTAAGGCTGTGGACGCCTTCAAGTCTGCCCCACTGTATCAGAGGCCAGGCTACTACAGTGCCCCACAGACGCCCCTCAGCCCCACTCCCATGTTCTTCCCCCTAGAACCATCAGCGCCGTCAAAGCTTCACAGTGTCACAGGCATAGACACCAAAGACAAAAGCTTAAAGACTGTGAGTTCTGGGGCCAAGAAAAGTTTTGAATTGCTCTCAGAGAGCGATGGGGCCTTGATGGAGCACCCAGAAGTATCTCAAGTGAGGAGGAAAACTGTGGAGTTTAACCTGACGGATATGCCAGAGATCCCCGAAAATCACCTCAAAGAACCTTTGGAACAATCACCAACCAACATACACACTACACTCAAAGATCACATGGATCCTTATTGGGCCTTGGAAAACAGGGATGAAGCACATTCCTAA

Back to List