Details for gene: IFT88


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; centriole : A cellular organelle, found close to the nucleus in many eukaryotic cells, consisting of a small cylinder with microtubular walls, 300-500 nm long and 150-250 nm in diameter. It contains nine short, parallel, peripheral microtubular fibrils, each fibril consisting of one complete microtubule fused to two incomplete microtubules. Cells usually have two centrioles, lying at right angles to each other. At division, each pair of centrioles generates another pair and the twin pairs form the pole of the mitotic spindle. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; motile cilium : A cilium which may have a variable arrangement of axonemal microtubules and also contains molecular motors. It may beat with a whip-like pattern that promotes cell motility or transport of fluids and other cells across a cell surface, such as on epithelial cells that line the lumenal ducts of various tissues; or they may display a distinct twirling motion that directs fluid flow asymmetrically across the cellular surface to affect asymmetric body plan organization. Motile cilia can be found in single as well as multiple copies per cell. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; cilium assembly : The assembly of a cilium, a specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface. Each cilium is bounded by an extrusion of the cytoplasmic membrane, and contains a regular longitudinal array of microtubules, anchored basally in a centriole. ; cell projection organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a prolongation or process extending from a cell, e.g. a flagellum or axon. ; microtubule organizing center : An intracellular structure that can catalyze gamma-tubulin-dependent microtubule nucleation and that can anchor microtubules by interacting with their minus ends, plus ends or sides. ; centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ; ciliary base : Area of the cilium (also called flagellum) where the basal body and the axoneme are anchored to the plasma membrane. The ciliary base encompasses the distal part of the basal body, transition fibers and transition zone and is structurally and functionally very distinct from the rest of the cilium. In this area proteins are sorted and filtered before entering the cilium, and many ciliary proteins localize specifically to this area. ; ciliary basal body : A membrane-tethered, short cylindrical array of microtubules and associated proteins found at the base of a eukaryotic cilium (also called flagellum) that is similar in structure to a centriole and derives from it. The cilium basal body is the site of assembly and remodelling of the cilium and serves as a nucleation site for axoneme growth. As well as anchoring the cilium, it is thought to provide a selective gateway regulating the entry of ciliary proteins and vesicles by intraflagellar transport. ; ciliary tip : Part of the cilium where the axoneme ends. The ciliary tip has been implicated in ciliary assembly and disassembly, as well as signal transduction. ; intraciliary transport particle B : The larger subcomplex of the intraciliary transport particle; characterized complexes have molecular weights around 550 kDa. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; regulation of cilium assembly : Any process that modulates the frequency, rate or extent of cilium assembly. ; non-motile cilium : A cilium which may have a variable array of axonemal microtubules but does not contain molecular motors. ; sperm flagellum : A microtubule-based flagellum (or cilium) that is part of a sperm, a mature male germ cell that develops from a spermatid. ; inner ear receptor cell stereocilium organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a stereocilium. A stereocilium is an actin-based protrusion from the apical surface of inner ear receptor cells. ; kinesin binding : Interacting selectively and non-covalently and stoichiometrically with kinesin, a member of a superfamily of microtubule-based motor proteins that perform force-generating tasks such as organelle transport and chromosome segregation. ; kidney development : The process whose specific outcome is the progression of the kidney over time, from its formation to the mature structure. The kidney is an organ that filters the blood and/or excretes the end products of body metabolism in the form of urine. ; non-motile cilium assembly : The aggregation, arrangement and bonding together of a set of components to form a non-motile cilium. ; intraciliary transport : The bidirectional movement of large protein complexes along microtubules within a cilium, mediated by motor proteins. ; regulation of autophagosome assembly : Any process that modulates the frequency, rate or extent of autophagosome assembly. ; transferase activity : Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2. ; gibberellic acid mediated signaling pathway : A series of molecular signals mediated by the detection of gibberellic acid. ;


Symbol
IFT88
Name
intraflagellar transport 88
Entrez ID
8100
Ensembl ID
ENSG00000032742    (more details)
KEGG ID
hsa:8100    (more details)
OMIM ID
600595
Uniprot ID
B3KX42  
GO ID
hsa:8100    (more details)
Chromosome
17
Strand
1
Start
81650459
End
81663112
miRNA Interactions
hsa-miR-212-3p (RPM: 7.7608) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-548a-5p (RPM: 0.0098) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-210-3p (RPM: 361.0562) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Intraflagellar transport / Hedgehog 'off' state /
Sequence
ATGATGCAAAATGTGCACCTGGCTCCAGAGACAGATGAAGATGATCTTTATTCCGGCTATAATGACTACAATCCAATCTATGATATCGAGGAATTGGAGAATGATGCAGCTTTTCAGCAAGCTGTGAGGACTAGTCATGGCAGAAGACCTCCAATAACTGCTAAAATATCAAGCACGGCAGTTACTAGACCTATAGCTACTGGATATGGGTCCAAGACATCTCTGGCATCATCAATAGGAAGACCAATGACAGGGGCTATTCAGGATGGAGTTACTAGACCCATGACAGCAGTGAGAGCAGCTGGTTTTACCAAAGCAGCTTTGAGAGGCTCTGCATTTGACCCCCTTAGTCAGTCAAGGGGCCCTGCTTCCCCTTTGGAAGCCAAGAAAAAAGATAGCCCAGAGGAAAAAATAAAGCAATTAGAGAAGGAAGTAAATGAGTTGGTAGAAGAAAGCTGTATTGCCAATAGTTGTGGAGACTTAAAATTGGCCTTAGAAAAGGCAAAAGATGCAGGAAGAAAAGAGAGAGTCCTGGTGAGACAGCGAGAACAAGTTACAACTCCAGAAAATATCAATTTGGATTTAACTTACTCAGTTCTTTTCAATTTGGCCAGTCAGTATTCAGTTAATGAAATGTATGCCGAAGCACTTAACACTTATCAAGTTATAGTCAAAAATAAGATGTTTAGCAATGCAGGAATATTGAAAATGAATATGGGAAATATCTATTTAAAGCAAAGAAATTATTCCAAAGCCATTAAATTCTACCGAATGGCATTAGACCAAGTTCCAAGTGTCAATAAGCAAATGAGGATTAAAATAATGCAGAATATTGGAGTTACATTTATTCAGGCTGGTCAGTATTCAGATGCTATTAATTCATATGAGCACATAATGAGCATGGCACCAAATCTGAAGGCAGGCTACAACCTAACTATCTGTTATTTTGCTATTGGAGACCGAGAAAAAATGAAGAAGGCATTCCAAAAATTGATTACTGTTCCATTAGAAATTGATGAAGATAAATATATTTCACCAAGTGATGATCCTCATACTAACTTAGTAACTGAAGCTATAAAAAATGATCACCTCAGGCAAATGGAACGTGAAAGGAAAGCCATGGCAGAAAAATATATTATGACATCTGCAAAACTCATTGCTCCTGTAATTGAAACATCTTTTGCTGCAGGTTATGATTGGTGCGTGGAAGTGGTGAAAGCTTCTCAATATGTAGAGCTAGCCAATGATCTGGAAATAAACAAAGCAGTTACATACTTGAGACAAAAAGACTATAACCAAGCTGTAGAGATCTTAAAAGTGTTGGAAAAAAAGGACAGTAGAGTGAAAAGTGCAGCTGCAACCAATCTCTCAGCCCTGTATTATATGGGAAAGGATTTTGCACAAGCCAGCAGCTATGCAGATATAGCTGTGAACTCTGATAGATATAATCCAGCAGCTCTTACTAATAAAGGGAATACAGTTTTTGCAAATGGTGATTATGAGAAGGCCGCTGAATTCTATAAAGAGGCTCTAAGAAATGATTCTTCTTGTACTGAAGCACTTTATAATATTGGCCTTACCTATGAGAAACTAAATCGGCTAGATGAGGCTTTGGACTGTTTCCTGAAACTTCACGCAATCCTACGAAACAGTGCCGAAGTTCTTTACCAGATAGCAAATATATATGAATTAATGGAAAATCCCAGTCAAGCTATTGAATGGCTAATGCAGGTGGTCAGTGTTATTCCAACCGATCCTCAAGTTTTATCTAAGCTAGGAGAATTATATGATCGTGAAGGAGATAAATCTCAAGCATTTCAATATTACTATGAGTCATATAGGTATTTTCCTTGTAATATTGAAGTCATTGAGTGGCTTGGAGCCTATTACATTGACACCCAATTTTGGGAAAAAGCTATTCAGTACTTTGAAAGAGCTTCTCTTATACAGCCTACACAAGTGAAATGGCAGCTGATGGTAGCTAGTTGTTTCAGAAGAAGTGGTAACTACCAAAAAGCATTAGATACTTACAAAGATACTCACAGAAAATTTCCAGAAAATGTCGAATGTCTGCGTTTCTTAGTTCGTCTCTGCACAGATCTTGGATTAAAAGATGCTCAAGAATATGCCAGAAAACTGAAGAGGTTGGAAAAAATGAAAGAAATAAGGGAACAGCGCATAAAGTCAGGCAGAGATGGCAGTGGGGGCTCCCGTGGCAAAAGAGAAGGAAGTGCTAGCGGTGATAGTGGCCAGAACTATAGTGCCAGTAGTAAAGGTGAACGACTAAGTGCCAGACTCAGAGCTTTACCTGGGACAAATGAACCTTATGAAAGTAGCAGTAACAAAGAAATAGATGCCTCCTATGTGGACCCACTTGGCCCTCAAATAGAACGACCAAAAACTGCAGCCAAGAAAAGGATCGATGAGGATGATTTTGCTGATGAAGAATTAGGAGATGATTTGCTTCCAGAATAA

Back to List