Details for gene: PROM1


membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; cellular anatomical entity : A part of a cellular organism that is either an immaterial entity or a material entity with granularity above the level of a protein complex but below that of an anatomical system. Or, a substance produced by a cellular organism with granularity above the level of a protein complex. ; microvillus membrane : The portion of the plasma membrane surrounding a microvillus. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; apical plasma membrane : The region of the plasma membrane located at the apical end of the cell. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; endoplasmic reticulum-Golgi intermediate compartment : A complex system of membrane-bounded compartments located between endoplasmic reticulum (ER) and the Golgi complex, with a distinctive membrane protein composition; involved in ER-to-Golgi and Golgi-to-ER transport. ; vesicle : Any small, fluid-filled, spherical organelle enclosed by membrane. ; integral component of plasma membrane : The component of the plasma membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; cadherin binding : Interacting selectively and non-covalently with cadherin, a type I membrane protein involved in cell adhesion. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; retina layer formation : The process in which the vertebrate retina is organized into three laminae: the outer nuclear layer (ONL), which contains photoreceptor nuclei; the inner nuclear layer (INL), which contains amacrine, bipolar and horizontal cells; and the retinal ganglion cell (RGC) layer. Between the inner and outer nuclear layers, the outer plexiform layer (OPL) contains connections between the photoreceptors and bipolar and horizontal cells. The inner plexiform layer (IPL) is positioned between the INL and the ganglion cell layer and contains the dendrites of RGCs and processes of bipolar and amacrine cells. Spanning all layers of the retina are the radially oriented Mueller glia. ; cell surface : The external part of the cell wall and/or plasma membrane. ; microvillus : Thin cylindrical membrane-covered projections on the surface of an animal cell containing a core bundle of actin filaments. Present in especially large numbers on the absorptive surface of intestinal cells. ; cholesterol binding : Interacting selectively and non-covalently with cholesterol (cholest-5-en-3-beta-ol); the principal sterol of vertebrates and the precursor of many steroids, including bile acids and steroid hormones. ; actinin binding : Interacting selectively and non-covalently with actinin, any member of a family of proteins that crosslink F-actin. ; photoreceptor cell maintenance : Any process preventing the degeneration of the photoreceptor, a specialized cell type that is sensitive to light. ; retina morphogenesis in camera-type eye : The process in which the anatomical structure of the retina is generated and organized. ; camera-type eye photoreceptor cell differentiation : The process in which a relatively unspecialized cell acquires the specialized features of a photoreceptor cell in a camera-type eye. ; glomerular visceral epithelial cell differentiation : The process in which a relatively unspecialized cell acquires specialized features of a glomerular visceral epithelial cell. A glomerular visceral epithelial cell is a specialized epithelial cell that contains 'feet' that interdigitate with the 'feet' of other glomerular epithelial cells. ; glomerular parietal epithelial cell differentiation : The process in which a relatively unspecialized cell acquires specialized features of a glomerular parietal epithelial cell. Glomerular parietal epithelial cells are specialized epithelial cells that form tight junctions as a barrier to protein transport. ; positive regulation of nephron tubule epithelial cell differentiation : Any process that activates or increases the frequency, rate or extent of nephron tubule epithelial cell differentiation. ; prominosome : An extracellular membrane-bounded vesicle that contains prominin proteins (in mouse Prom1/CD33 or Prom2) and are found in body fluids including ventricular fluid, saliva, urine and seminal fluid. In the ventricular fluid of the developing mouse brain two major classes of these particles have been observed (P2 particles of 500-1000 nm and P4 particles of 50-80 nm) which likely originate from microvilli, primary cilia and/or the midbody of neuroepithelial cells. The physiological role is not known. ; photoreceptor outer segment membrane : The membrane surrounding the outer segment of a vertebrate photoreceptor. ;


Symbol
PROM1
Name
prominin 1
Entrez ID
8842
Ensembl ID
ENSG00000007062    (more details)
KEGG ID
hsa:8842    (more details)
OMIM ID
603786
Uniprot ID
A0A0A0N0M1  
GO ID
hsa:8842    (more details)
Chromosome
1
Strand
-1
Start
150321479
End
150353233
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-4753-3p (RPM: 0.0312) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-373-3p (RPM: 0.0958) / hsa-miR-200b-5p (RPM: 9.0166) / hsa-miR-142-3p (RPM: 8.3404) / hsa-miR-130b-5p (RPM: 60.0122) / hsa-miR-514b-5p (RPM: 0.0618) / hsa-miR-513c-5p (RPM: 0.9144) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-183-3p (RPM: 43.8344) / hsa-miR-126-3p (RPM: 494.5936) / hsa-miR-6873-3p (RPM: 0.12) / hsa-miR-7110-3p (RPM: 0.0382) / hsa-miR-6817-3p (RPM: 0.0036) / hsa-miR-487b-5p (RPM: 0.5882) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Transcriptional misregulation in cancer /
Sequence
ATGGCCCTCGTACTCGGCTCCCTGTTGCTGCTGGGGCTGTGCGGGAACTCCTTTTCAGGAGGGCAGCCTTCATCCACAGATGCTCCTAAGGCTTGGAATTATGAATTGCCTGCAACAAATTATGAGACCCAAGACTCCCATAAAGCTGGACCCATTGGCATTCTCTTTGAACTAGTGCATATCTTTCTCTATGTGGTACAGCCGCGTGATTTCCCAGAAGATACTTTGAGAAAATTCTTACAGAAGGCATATGAATCCAAAATTGATTATGACAAGCCAGAAACTGTAATCTTAGGTCTAAAGATTGTCTACTATGAAGCAGGGATTATTCTATGCTGTGTCCTGGGGCTGCTGTTTATTATTCTGATGCCTCTGGTGGGGTATTTCTTTTGTATGTGTCGTTGCTGTAACAAATGTGGTGGAGAAATGCACCAGCGACAGAAGGAAAATGGGCCCTTCCTGAGGAAATGCTTTGCAATCTCCCTGTTGGTGATTTGTATAATAATAAGCATTGGCATCTTCTATGGTTTTGTGGCAAATCACCAGGTAAGAACCCGGATCAAAAGGAGTCGGAAACTGGCAGATAGCAATTTCAAGGACTTGCGAACTCTCTTGAATGAAACTCCAGAGCAAATCAAATATATATTGGCCCAGTACAACACTACCAAGGACAAGGCGTTCACAGATCTGAACAGTATCAATTCAGTGCTAGGAGGCGGAATTCTTGACCGACTGAGACCCAACATCATCCCTGTTCTTGATGAGATTAAGTCCATGGCAACAGCGATCAAGGAGACCAAAGAGGCGTTGGAGAACATGAACAGCACCTTGAAGAGCTTGCACCAACAAAGTACACAGCTTAGCAGCAGTCTGACCAGCGTGAAAACTAGCCTGCGGTCATCTCTCAATGACCCTCTGTGCTTGGTGCATCCATCAAGTGAAACCTGCAACAGCATCAGATTGTCTCTAAGCCAGCTGAATAGCAACCCTGAACTGAGGCAGCTTCCACCCGTGGATGCAGAACTTGACAACGTTAATAACGTTCTTAGGACAGATTTGGATGGCCTGGTCCAACAGGGCTATCAATCCCTTAATGATATACCTGACAGAGTACAACGCCAAACCACGACTGTCGTAGCAGGTATCAAAAGGGTCTTGAATTCCATTGGTTCAGATATCGACAATGTAACTCAGCGTCTTCCTATTCAGGATATACTCTCAGCATTCTCTGTTTATGTTAATAACACTGAAAGTTACATCCACAGAAATTTACCTACATTGGAAGAGTATGATTCATACTGGTGGCTGGGTGGCCTGGTCATCTGCTCTCTGCTGACCCTCATCGTGATTTTTTACTACCTGGGCTTACTGTGTGGCGTGTGCGGCTATGACAGGCATGCCACCCCGACCACCCGAGGCTGTGTCTCCAACACCGGAGGCGTCTTCCTCATGGTTGGAGTTGGATTAAGTTTCCTCTTTTGCTGGATATTGATGATCATTGTGGTTCTTACCTTTGTCTTTGGTGCAAATGTGGAAAAACTGATCTGTGAACCTTACACGAGCAAGGAATTATTCCGGGTTTTGGATACACCCTACTTACTAAATGAAGACTGGGAATACTATCTCTCTGGGAAGCTATTTAATAAATCAAAAATGAAGCTCACTTTTGAACAAGTTTACAGTGACTGCAAAAAAAATAGAGGCACTTACGGCACTCTTCACCTGCAGAACAGCTTCAATATCAGTGAACATCTCAACATTAATGAGCATACTGGAAGCATAAGCAGTGAATTGGAAAGTCTGAAGGTAAATCTTAATATCTTTCTGTTGGGTGCAGCAGGAAGAAAAAACCTTCAGGATTTTGCTGCTTGTGGAATAGACAGAATGAATTATGACAGCTACTTGGCTCAGACTGGTAAATCCCCCGCAGGAGTGAATCTTTTATCATTTGCATATGATCTAGAAGCAAAAGCAAACAGTTTGCCCCCAGGAAATTTGAGGAACTCCCTGAAAAGAGATGCACAAACTATTAAAACAATTCACCAGCAACGAGTCCTTCCTATAGAACAATCACTGAGCACTCTATACCAAAGCGTCAAGATACTTCAACGCACAGGGAATGGATTGTTGGAGAGAGTAACTAGGATTCTAGCTTCTCTGGATTTTGCTCAGAACTTCATCACAAACAATACTTCCTCTGTTATTATTGAGGAAACTAAGAAGTATGGGAGAACAATAATAGGATATTTTGAACATTATCTGCAGTGGATCGAGTTCTCTATCAGTGAGAAAGTGGCATCGTGCAAACCTGTGGCCACCGCTCTAGATACTGCTGTTGATGTCTTTCTGTGTAGCTACATTATCGACCCCTTGAATTTGTTTTGGTTTGGCATAGGAAAAGCTACTGTATTTTTACTTCCGGCTCTAATTTTTGCGGTAAAACTGGCTAAGTACTATCGTCGAATGGATTCGGAGGACGTGTACGATGATGTTGAAACTATACCCATGAAAAATATGGAAAATGGTAATAATGGTTATCATAAAGATCATGTATATGGTATTCACAATCCTGTTATGACAAGCCCATCACAACATTGA

Back to List