Details for gene: UNC119


nervous system development : The process whose specific outcome is the progression of nervous tissue over time, from its formation to its mature state. ; lipid binding : Interacting selectively and non-covalently with a lipid. ; spindle pole : Either of the ends of a spindle, where spindle microtubules are organized; usually contains a microtubule organizing center and accessory molecules, spindle microtubules and astral microtubules. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; protein transport : The directed movement of proteins into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; synapse : The junction between an axon of one neuron and a dendrite of another neuron, a muscle fiber or a glial cell. As the axon approaches the synapse it enlarges into a specialized structure, the presynaptic terminal bouton, which contains mitochondria and synaptic vesicles. At the tip of the terminal bouton is the presynaptic membrane; facing it, and separated from it by a minute cleft (the synaptic cleft) is a specialized area of membrane on the receiving cell, known as the postsynaptic membrane. In response to the arrival of nerve impulses, the presynaptic terminal bouton secretes molecules of neurotransmitters into the synaptic cleft. These diffuse across the cleft and transmit the signal to the postsynaptic membrane. ; microtubule organizing center : An intracellular structure that can catalyze gamma-tubulin-dependent microtubule nucleation and that can anchor microtubules by interacting with their minus ends, plus ends or sides. ; spindle : The array of microtubules and associated molecules that forms between opposite poles of a eukaryotic cell during mitosis or meiosis and serves to move the duplicated chromosomes apart. ; endocytosis : A vesicle-mediated transport process in which cells take up external materials or membrane constituents by the invagination of a small region of the plasma membrane to form a new membrane-bounded vesicle. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ; intercellular bridge : A direct connection between the cytoplasm of two cells that is formed following the completion of cleavage furrow ingression during cell division. They are usually present only briefly prior to completion of cytokinesis. However, in some cases, such as the bridges between germ cells during their development, they become stabilised. ; mitotic cytokinesis : A cell cycle process that results in the division of the cytoplasm of a cell after mitosis, resulting in the separation of the original cell into two daughter cells. ; positive regulation of protein tyrosine kinase activity : Any process that increases the rate, frequency, or extent of protein tyrosine kinase activity. ; spindle midzone : The area in the center of the spindle where the spindle microtubules from opposite poles overlap. ; lipoprotein transport : The directed movement of any conjugated, water-soluble protein in which the nonprotein group consists of a lipid or lipids, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; chemical synaptic transmission : The vesicular release of classical neurotransmitter molecules from a presynapse, across a chemical synapse, the subsequent activation of neurotransmitter receptors at the postsynapse of a target cell (neuron, muscle, or secretory cell) and the effects of this activation on the postsynaptic membrane potential and ionic composition of the postsynaptic cytosol. This process encompasses both spontaneous and evoked release of neurotransmitter and all parts of synaptic vesicle exocytosis. Evoked transmission starts with the arrival of an action potential at the presynapse. ; phototransduction : The sequence of reactions within a cell required to convert absorbed photons into a molecular signal. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; negative regulation of clathrin-dependent endocytosis : Any process that stops, prevents or reduces the frequency, rate or extent of clathrin-mediated endocytosis. ; negative regulation of caveolin-mediated endocytosis : Any process that stops, prevents or reduces the frequency, rate or extent of caveolin-mediated endocytosis. ;


Symbol
UNC119
Name
unc-119 lipid binding chaperone
Entrez ID
9094
Ensembl ID
ENSG00000109103    (more details)
KEGG ID
hsa:9094    (more details)
OMIM ID
604011
Uniprot ID
K7EN86  
GO ID
hsa:9094    (more details)
Chromosome
9
Strand
-1
Start
113275642
End
113294009
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-183-5p (RPM: 37556.6894) / hsa-miR-1301-3p (RPM: 47.2112) / hsa-miR-3943 (RPM: 0.8342) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-141-5p (RPM: 20.664) / hsa-miR-4726-3p (RPM: 0.0088) / hsa-miR-615-3p (RPM: 0.1424) / hsa-miR-708-5p (RPM: 69.2328) / hsa-miR-188-5p (RPM: 3.7746) / hsa-miR-361-3p (RPM: 73.5598) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-3615 (RPM: 64.4484) / hsa-miR-188-3p (RPM: 0.727) / hsa-miR-4685-3p (RPM: 0.7634) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-10b-5p (RPM: 14052.6542) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGAAGGTGAAGAAGGGCGGCGGTGGGGCCGGGACGGCGACGGAGTCCGCTCCGGGGCCCTCGGGCCAGAGCGTGGCCCCCATACCACAGCCGCCTGCGGAATCCGAATCTGGGTCCGAGTCGGAGCCGGACGCAGGCCCAGGGCCCAGGCCGGGGCCGCTGCAGAGGAAGCAGCCGATCGGGCCGGAGGACGTGCTGGGGCTGCAGCGGATCACCGGTGACTACCTCTGCTCCCCTGAGGAGAATATCTACAAGATCGACTTTGTCAGGTTTAAGATTCGGGACATGGACTCAGGCACTGTCCTCTTTGAAATCAAGAAGCCCCCAGTCTCAGAACGGTTGCCCATCAACCGGCGGGACCTGGACCCCAATGCTGGGCGCTTTGTCCGCTACCAGTTCACGCCTGCCTTCCTCCGCCTGAGGCAGGTGGGAGCCACGGTGGAGTTCACAGTGGGAGACAAGCCTGTCAACAACTTCCGCATGATCGAGAGGCACTACTTCCGCAACCAGCTACTCAAAAGCTTCGACTTCCACTTTGGCTTCTGCATCCCCAGCAGCAAGAACACCTGCGAGCACATTTACGACTTCCCCCCTCTCTCCGAGGAGCTGATCAGCGAGATGATCCGCCACCCGTATGAGACCCAGTCTGACAGCTTCTACTTCGTGGATGACCGGCTGGTGATGCACAATAAAGCAGACTATTCCTACAGCGGGACACCCTGA

Back to List