Details for gene: PRPF4


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; Cajal body : A class of nuclear body, first seen after silver staining by Ramon y Cajal in 1903, enriched in small nuclear ribonucleoproteins, and certain general RNA polymerase II transcription factors; ultrastructurally, they appear as a tangle of coiled, electron-dense threads roughly 0.5 micrometers in diameter; involved in aspects of snRNP biogenesis; the protein coilin serves as a marker for Cajal bodies. Some argue that Cajal bodies are the sites for preassembly of transcriptosomes, unitary particles involved in transcription and processing of RNA. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; spliceosomal complex : Any of a series of ribonucleoprotein complexes that contain snRNA(s) and small nuclear ribonucleoproteins (snRNPs), and are formed sequentially during the spliceosomal splicing of one or more substrate RNAs, and which also contain the RNA substrate(s) from the initial target RNAs of splicing, the splicing intermediate RNA(s), to the final RNA products. During cis-splicing, the initial target RNA is a single, contiguous RNA transcript, whether mRNA, snoRNA, etc., and the released products are a spliced RNA and an excised intron, generally as a lariat structure. During trans-splicing, there are two initial substrate RNAs, the spliced leader RNA and a pre-mRNA. ; mRNA processing : Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide. ; RNA splicing : The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA. ; nuclear speck : A discrete extra-nucleolar subnuclear domain, 20-50 in number, in which splicing factors are seen to be localized by immunofluorescence microscopy. ; mRNA splicing, via spliceosome : The joining together of exons from one or more primary transcripts of messenger RNA (mRNA) and the excision of intron sequences, via a spliceosomal mechanism, so that mRNA consisting only of the joined exons is produced. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; U4/U6 x U5 tri-snRNP complex : A ribonucleoprotein complex that is formed by the association of the U4/U6 and U5 snRNPs. ; RNA splicing, via transesterification reactions : Splicing of RNA via a series of two transesterification reactions. ; U2-type precatalytic spliceosome : A spliceosomal complex that is formed by the recruitment of the preassembled U4/U6.U5 tri-snRNP to the prespliceosome. Although all 5 snRNPs are present, the precatalytic spliceosome is catalytically inactive. The precatalytic spliceosome includes many proteins in addition to those found in the U1, U2 and U4/U6.U5 snRNPs. ; U6 snRNA binding : Interacting selectively and non-covalently with the U6 small nuclear RNA (U6 snRNA). ; U4 snRNA binding : Interacting selectively and non-covalently with the U4 small nuclear RNA (U4 snRNA). ; RNA processing : Any process involved in the conversion of one or more primary RNA transcripts into one or more mature RNA molecules. ; U4/U6 snRNP : A ribonucleoprotein complex that contains the extensively base paired small nuclear RNAs U4 and U6, a heptameric ring of Sm proteins associated with U4, the Lsm2-8 heptameric ring complex associated with U6, as well as several proteins that are unique to the U4 snRNP or U6 snRNPs, some of which remain associated with the U4/U6 snRNA both while the U4 snRNP is free or assembled into a series of spliceosomal complexes. ; spliceosomal snRNP complex : A small ribonucleoprotein complex involved in formation of the spliceosome. ; cellular anatomical entity : A part of a cellular organism that is either an immaterial entity or a material entity with granularity above the level of a protein complex but below that of an anatomical system. Or, a substance produced by a cellular organism with granularity above the level of a protein complex. ;


Symbol
PRPF4
Name
pre-mRNA processing factor 4
Entrez ID
9128
Ensembl ID
ENSG00000136875    (more details)
KEGG ID
hsa:9128    (more details)
OMIM ID
607795
Uniprot ID
O43172  
GO ID
hsa:9128    (more details)
Chromosome
17
Strand
1
Start
1650629
End
1684867
miRNA Interactions
hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-1303 (RPM: 5.3758) / hsa-miR-454-3p (RPM: 66.0634) / hsa-miR-5001-3p (RPM: 0.622) / hsa-miR-513a-3p (RPM: 0.0492) / hsa-miR-590-3p (RPM: 4.5954) / hsa-miR-3127-3p (RPM: 0.1826) / hsa-miR-520c-3p (RPM: 0.0046) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-23b-5p (RPM: 1.333) / hsa-miR-125b-2-3p (RPM: 492.7724) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-130b-3p (RPM: 68.2014) / hsa-miR-450b-3p (RPM: 0.0026) / hsa-miR-519d-3p (RPM: 0.0042) / hsa-miR-148a-5p (RPM: 130.608) / hsa-miR-520d-3p (RPM: 0.0042) / hsa-miR-372-3p (RPM: 0.0034) / hsa-miR-301b-3p (RPM: 9.609) / hsa-miR-301a-3p (RPM: 142.8494) / hsa-miR-373-3p (RPM: 0.0958) / hsa-miR-130a-5p (RPM: 1.1956) / hsa-miR-520a-3p (RPM: 0.0858) / hsa-miR-519b-3p (RPM: 0.0036) / hsa-miR-1304-3p (RPM: 12.7066) / hsa-miR-302d-3p (RPM: 0.0012) / hsa-miR-519a-3p (RPM: 0.0036) / hsa-miR-519c-3p (RPM: 0.0096) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-302c-3p (RPM: 0.0012) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-302b-3p (RPM: 0.006) / hsa-miR-136-3p (RPM: 178.2682) / hsa-miR-27b-5p (RPM: 73.6964) / hsa-miR-33a-5p (RPM: 5.9422) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-3913-5p (RPM: 2.6744) / hsa-miR-141-5p (RPM: 20.664) / hsa-miR-1302 (RPM: 0.2314) / hsa-miR-4726-3p (RPM: 0.0088) / hsa-miR-769-3p (RPM: 3.6276) / hsa-miR-4284 (RPM: 0.1674) / hsa-miR-4438 (RPM: 0.0032) / hsa-miR-200a-5p (RPM: 14.0094) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-5089-5p (RPM: 0.0026) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-20b-5p (RPM: 24.4036) / hsa-miR-377-5p (RPM: 8.4706) / hsa-miR-4638-5p (RPM: 0.0318) / hsa-miR-1247-3p (RPM: 20.5724) / hsa-miR-1307-3p (RPM: 130.8454) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-6758-5p (RPM: 0.0478) / hsa-miR-6856-5p (RPM: 0.003) / hsa-miR-6778-3p (RPM: 0.0066) / hsa-miR-655-5p (RPM: 0.0912) / hsa-miR-619-5p (RPM: 1.5814) / hsa-miR-7151-3p (RPM: 0.0092) / hsa-miR-6764-5p (RPM: 0.111) / hsa-miR-6890-3p (RPM: 0.0048) / hsa-miR-6728-5p (RPM: 0.0148) / hsa-miR-6887-3p (RPM: 0.0038) / hsa-miR-6736-3p (RPM: 0.0064) / hsa-miR-6792-5p (RPM: 0.0042) / hsa-miR-6840-3p (RPM: 0.0218) / hsa-miR-6836-3p (RPM: 0.019) / hsa-miR-6829-3p (RPM: 0.0008) / hsa-miR-6791-3p (RPM: 0.0226) / hsa-miR-6513-5p (RPM: 0.1884) / hsa-miR-6807-5p (RPM: 0.028) / hsa-miR-6741-3p (RPM: 0.6252) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Spliceosome /
Sequence
ATGGCTTCCTCGCGAGCCTCTTCCACGCAGGCAACCAAAACTAAAGCACCCGACGACTTAGTTGCTCCGGTCGTGAAGAAACCACACATCTATTATGGAAGTTTGGAAGAGAAGGAGAGGGAGCGTCTGGCCAAAGGAGAGTCTGGGATTTTGGGGAAAGACGGACTTAAAGCAGGGATCGAAGCTGGAAATATTAATATAACCTCTGGAGAAGTGTTTGAAATTGAAGAGCATATCAGCGAGCGACAGGCAGAAGTATTGGCTGAGTTTGAGAGAAGGAAGCGAGCCCGGCAGATCAATGTTTCCACAGATGACTCAGAGGTCAAAGCTTGCCTTAGAGCCTTGGGGGAACCCATCACACTTTTTGGAGAGGGTCCTGCTGAAAGAAGAGAAAGGTTAAGAAATATCCTCTCAGTTGTCGGTACTGATGCCTTGAAAAAGACCAAAAAGGATGATGAGAAGTCTAAAAAGTCCAAAGAAGAGTATCAGCAAACCTGGTATCATGAAGGACCAAATAGCTTGAAGGTGGCAAGACTATGGATTGCTAATTATTCGTTGCCCAGGGCAATGAAACGCTTGGAAGAGGCCCGACTCCATAAGGAGATTCCTGAGACAACAAGGACCTCCCAGATGCAAGAGCTGCACAAGTCTCTCCGGTCTTTGAATAATTTTTGCAGTCAGATTGGGGATGATCGGCCTATCTCCTACTGTCACTTTAGTCCCAATTCCAAGATGCTGGCCACAGCTTGTTGGAGTGGGCTTTGCAAGCTCTGGTCTGTTCCTGATTGCAACCTCCTTCACACTCTTCGAGGGCATAACACAAATGTAGGAGCAATTGTATTCCATCCCAAATCCACTGTCTCCTTGGACCCAAAAGATGTCAACCTGGCCTCTTGTGCGGCTGATGGCTCTGTGAAGCTTTGGAGTCTCGACAGTGATGAACCAGTGGCAGATATTGAAGGCCATACAGTGCGTGTGGCGCGGGTAATGTGGCATCCTTCAGGACGTTTCCTGGGCACCACCTGCTATGACCGTTCATGGCGCTTATGGGATTTGGAGGCTCAAGAGGAGATCCTGCATCAGGAAGGCCATAGCATGGGTGTGTATGACATTGCCTTCCATCAAGATGGCTCTTTGGCTGGCACTGGGGGACTGGATGCATTTGGTCGAGTTTGGGACCTACGCACAGGACGTTGTATCATGTTCTTAGAAGGCCACCTGAAAGAAATCTATGGAATAAATTTCTCCCCCAATGGCTATCACATTGCAACCGGCAGTGGTGACAACACCTGCAAAGTGTGGGACCTCCGACAGCGGCGTTGCGTCTACACCATCCCTGCTCATCAGAACTTAGTGACTGGTGTCAAGTTTGAGCCTATCCATGGGAACTTCTTGCTTACTGGTGCCTATGATAACACAGCCAAGATCTGGACGCACCCAGGCTGGTCCCCGCTGAAGACTCTGGCTGGCCACGAAGGCAAAGTGATGGGCCTAGATATTTCTTCCGATGGGCAGCTCATAGCCACTTGCTCATATGACAGGACCTTCAAGCTGTGGATGGCTGAATAG

Back to List