Details for gene: PRPF3


mRNA processing : Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide. ; mRNA splicing, via spliceosome : The joining together of exons from one or more primary transcripts of messenger RNA (mRNA) and the excision of intron sequences, via a spliceosomal mechanism, so that mRNA consisting only of the joined exons is produced. ; U4/U6 x U5 tri-snRNP complex : A ribonucleoprotein complex that is formed by the association of the U4/U6 and U5 snRNPs. ; Cajal body : A class of nuclear body, first seen after silver staining by Ramon y Cajal in 1903, enriched in small nuclear ribonucleoproteins, and certain general RNA polymerase II transcription factors; ultrastructurally, they appear as a tangle of coiled, electron-dense threads roughly 0.5 micrometers in diameter; involved in aspects of snRNP biogenesis; the protein coilin serves as a marker for Cajal bodies. Some argue that Cajal bodies are the sites for preassembly of transcriptosomes, unitary particles involved in transcription and processing of RNA. ; RNA binding : Interacting selectively and non-covalently with an RNA molecule or a portion thereof. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; spliceosomal complex : Any of a series of ribonucleoprotein complexes that contain snRNA(s) and small nuclear ribonucleoproteins (snRNPs), and are formed sequentially during the spliceosomal splicing of one or more substrate RNAs, and which also contain the RNA substrate(s) from the initial target RNAs of splicing, the splicing intermediate RNA(s), to the final RNA products. During cis-splicing, the initial target RNA is a single, contiguous RNA transcript, whether mRNA, snoRNA, etc., and the released products are a spliced RNA and an excised intron, generally as a lariat structure. During trans-splicing, there are two initial substrate RNAs, the spliced leader RNA and a pre-mRNA. ; RNA splicing : The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA. ; nuclear speck : A discrete extra-nucleolar subnuclear domain, 20-50 in number, in which splicing factors are seen to be localized by immunofluorescence microscopy. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; RNA splicing, via transesterification reactions : Splicing of RNA via a series of two transesterification reactions. ; U2-type precatalytic spliceosome : A spliceosomal complex that is formed by the recruitment of the preassembled U4/U6.U5 tri-snRNP to the prespliceosome. Although all 5 snRNPs are present, the precatalytic spliceosome is catalytically inactive. The precatalytic spliceosome includes many proteins in addition to those found in the U1, U2 and U4/U6.U5 snRNPs. ; spliceosomal tri-snRNP complex assembly : The formation of a tri-snRNP complex containing U4 and U6 (or U4atac and U6atac) snRNAs and U5 snRNAs and associated proteins. This includes reannealing of U4 and U6 (or U4atac and U6atac) snRNAs released from previous rounds of splicing to reform the U4/U6 snRNP (or U4atac/U6atac snRNP) as well as the subsequent association of the U5 snRNP with the U4/U6 snRNP (or U4atac/U6atac snRNP) to form a tri-snRNP that is ready to reassemble into another spliceosome complex. ; protein-containing complex : A stable assembly of two or more macromolecules, i.e. proteins, nucleic acids, carbohydrates or lipids, in which at least one component is a protein and the constituent parts function together. ;


Symbol
PRPF3
Name
pre-mRNA processing factor 3
Entrez ID
9129
Ensembl ID
ENSG00000117360    (more details)
KEGG ID
hsa:9129    (more details)
OMIM ID
601414
Uniprot ID
O43395  
GO ID
hsa:9129    (more details)
Chromosome
10
Strand
1
Start
47348363
End
47357881
miRNA Interactions
hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-423-5p (RPM: 976.289) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-450b-5p (RPM: 4.6184) / hsa-miR-3187-3p (RPM: 1.1952) / hsa-miR-23a-5p (RPM: 7.4168) / hsa-miR-503-5p (RPM: 0.0972) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-32-3p (RPM: 2.4438) / hsa-miR-23b-5p (RPM: 1.333) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-30e-3p (RPM: 538.304) / hsa-miR-30a-3p (RPM: 889.1386) / hsa-miR-2355-3p (RPM: 0.4574) / hsa-miR-30d-3p (RPM: 57.136) / hsa-miR-301a-5p (RPM: 0.6676) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-625-5p (RPM: 10.5462) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-193b-5p (RPM: 3.2336) / hsa-miR-10b-3p (RPM: 1.0348) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Spliceosome /
Sequence
ATGGCACTGTCAAAGAGGGAGCTGGATGAGCTGAAACCATGGATAGAGAAGACAGTGAAGAGGGTCCTGGGTTTCTCAGAGCCTACGGTGGTCACAGCAGCATTGAACTGTGTGGGGAAGGGCATGGACAAGAAGAAGGCAGCCGATCATCTGAAACCTTTTCTTGATGATTCTACTCTCCGATTTGTGGACAAACTGTTTGAGGCTGTGGAGGAAGGCCGAAGCTCTAGGCATTCCAAGTCTAGCAGTGACAGGAGCAGAAAACGAGAGCTAAAGGAGGTGTTTGGTGATGACTCTGAGATCTCTAAAGAATCATCAGGAGTAAAGAAGCGACGAATACCCCGTTTTGAGGAGGTGGAAGAAGAGCCAGAGGTGATCCCTGGGCCTCCATCAGAGAGCCCTGGCATGCTGACTAAGCTCCAGATCAAACAGATGATGGAGGCAGCAACACGACAAATCGAGGAGAGGAAAAAACAGCTGAGCTTCATTAGCCCCCCTACACCTCAGCCAAAGACTCCTTCTTCCTCCCAACCAGAACGACTTCCTATTGGCAACACTATTCAGCCCTCCCAGGCTGCCACTTTCATGAATGATGCCATTGAGAAGGCAAGGAAAGCAGCTGAACTGCAAGCTCGAATCCAAGCCCAGCTGGCACTGAAGCCAGGACTCATCGGCAATGCCAACATGGTGGGCCTGGCTAATCTCCATGCCATGGGCATTGCTCCCCCGAAGGTGGAGTTAAAAGACCAAACGAAACCTACACCACTGATCCTGGATGAGCAAGGGCGCACTGTAGATGCAACAGGCAAGGAGATTGAGCTGACACACCGCATGCCTACTCTGAAAGCCAATATTCGTGCTGTGAAGAGGGAACAATTCAAGCAACAACTAAAGGAAAAGCCATCAGAAGACATGGAATCCAATACCTTTTTTGACCCCCGAGTCTCCATTGCCCCTTCCCAGCGCCAGAGACGCACTTTTAAATTCCATGACAAGGGCAAATTTGAGAAGATTGCTCAGCGATTACGGACAAAGGCTCAACTGGAGAAGCTACAGGCAGAGATTTCACAAGCAGCTCGAAAAACAGGCATCCATACTTCGACTAGGCTTGCCCTCATTGCTCCTAAGAAGGAGCTAAAGGAAGGAGATATTCCTGAAATTGAGTGGTGGGACTCTTACATAATCCCCAATGGCTTTGATCTTACAGAGGAAAATCCCAAGAGAGAAGATTATTTTGGAATCACAAATCTTGTTGAACATCCAGCCCAGCTCAATCCTCCAGTTGACAATGACACACCAGTTACTCTGGGAGTATATCTTACCAAGAAGGAACAGAAAAAACTTCGGAGACAAACAAGGAGGGAAGCACAGAAGGAACTACAAGAAAAAGTCAGGCTGGGCCTGATGCCTCCTCCAGAACCCAAAGTGAGAATTTCTAATTTGATGCGAGTATTAGGAACAGAAGCTGTTCAAGACCCCACGAAGGTAGAAGCCCACGTCAGAGCTCAGATGGCAAAAAGACAGAAAGCGCATGAAGAGGCCAACGCTGCCCGAAAACTCACAGCAGAACAGAGAAAGGTCAAGAAAATTAAAAAGCTTAAAGAAGACATTTCACAGGGGGTACACATATCTGTATATAGAGTTCGAAATTTGAGCAACCCAGCCAAGAAGTTCAAGATTGAAGCCAATGCTGGGCAACTGTACCTGACAGGGGTGGTGGTACTGCACAAGGATGTCAACGTGGTAGTAGTGGAAGGGGGCCCCAAGGCCCAGAAGAAATTTAAGCGTCTTATGCTGCATCGGATAAAGTGGGATGAACAGACATCTAACACAAAGGGAGATGATGATGAGGAGTCTGATGAGGAAGCTGTGAAGAAAACCAACAAATGTGTACTAGTCTGGGAGGGTACAGCCAAAGACCGGAGCTTTGGAGAGATGAAGTTTAAACAGTGTCCTACAGAGAACATGGCTCGTGAGCATTTCAAAAAGCATGGGGCTGAACACTACTGGGACCTTGCGCTGAGTGAATCTGTGTTAGAGTCCACTGATTGA

Back to List