Details for gene: LRAT


retinol metabolic process : The chemical reactions and pathways involving retinol, one of the three compounds that makes up vitamin A. ; phosphatidylcholine-retinol O-acyltransferase activity : Catalysis of the reaction: retinol-[cellular-retinol-binding-protein] + phosphatidylcholine = retinyl-ester-[cellular-retinol-binding-protein] + 2-acylglycerophosphocholine. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; transferase activity : Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; endoplasmic reticulum membrane : The lipid bilayer surrounding the endoplasmic reticulum. ; endosome : A vacuole to which materials ingested by endocytosis are delivered. ; rough endoplasmic reticulum : The rough (or granular) endoplasmic reticulum (ER) has ribosomes adhering to the outer surface; the ribosomes are the site of translation of the mRNA for those proteins which are either to be retained within the cisternae (ER-resident proteins), the proteins of the lysosomes, or the proteins destined for export from the cell. Glycoproteins undergo their initial glycosylation within the cisternae. ; acyltransferase activity : Catalysis of the transfer of an acyl group from one compound (donor) to another (acceptor). ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; perinuclear region of cytoplasm : Cytoplasm situated near, or occurring around, the nucleus. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; multivesicular body : A type of endosome in which regions of the limiting endosomal membrane invaginate to form internal vesicles; membrane proteins that enter the internal vesicles are sequestered from the cytoplasm. ; retinoid metabolic process : The chemical reactions and pathways involving retinoids, any member of a class of isoprenoids that contain or are derived from four prenyl groups linked head-to-tail. Retinoids include retinol and retinal and structurally similar natural derivatives or synthetic compounds, but need not have vitamin A activity. ; vitamin A metabolic process : The chemical reactions and pathways involving any of the vitamin A compounds, retinol, retinal (retinaldehyde) and retinoic acid, all of which are derivatives of beta-carotene. ; O-palmitoyltransferase activity : Catalysis of the transfer of a palmitoyl group to an oxygen atom on the acceptor molecule. ; lecithin:11-cis retinol acyltransferase activity : Catalysis of the reaction: an 11-cis retinol-[cellular-retinol-binding-protein] + a phosphatidylcholine <=> a cellular-retinol-binding protein + an 11-cis-retinyl ester + a 1-lysophosphatidylcholine. ; retinoic acid binding : Interacting selectively and non-covalently with retinoic acid, 3,7-dimethyl-9-(2,6,-trimethyl-1-cyclohexen-1-yl)-2,4,6,8-nonatetraenoic acid. ; O-acyltransferase activity : Catalysis of the transfer of an acyl group to an oxygen atom on the acceptor molecule. ; retinol binding : Interacting selectively and non-covalently with retinol, vitamin A1, 2,6,6-trimethyl-1-(9'-hydroxy-3',7'-dimethylnona-1',3',5',7'-tetraenyl)cyclohex-1-ene, one of the three components that makes up vitamin A. Retinol is an intermediate in the vision cycle and it also plays a role in growth and differentiation. ; response to bacterium : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus from a bacterium. ; positive regulation of lipid transport : Any process that activates or increases the frequency, rate or extent of the directed movement of lipids into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; response to retinoic acid : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a retinoic acid stimulus. ; response to vitamin A : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a vitamin A stimulus. ; cellular response to leukemia inhibitory factor : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a leukemia inhibitory factor stimulus. ; intracellular membrane-bounded organelle : Organized structure of distinctive morphology and function, bounded by a single or double lipid bilayer membrane and occurring within the cell. Includes the nucleus, mitochondria, plastids, vacuoles, and vesicles. Excludes the plasma membrane. ;


Symbol
LRAT
Name
lecithin retinol acyltransferase
Entrez ID
9227
Ensembl ID
ENSG00000121207    (more details)
KEGG ID
hsa:9227    (more details)
OMIM ID
268000
Uniprot ID
O95237  
GO ID
hsa:9227    (more details)
Chromosome
10
Strand
1
Start
93591687
End
93601744
miRNA Interactions
hsa-miR-2276-3p (RPM: 0.6192) / hsa-miR-129-5p (RPM: 135.1492) / hsa-miR-1289 (RPM: 0.0108) / hsa-miR-607 (RPM: 0.001) / hsa-miR-3198 (RPM: 0.0072) / hsa-miR-4430 (RPM: 0.0026) / hsa-miR-4770 (RPM: 0.0012) / hsa-miR-1304-3p (RPM: 12.7066) / hsa-miR-551b-5p (RPM: 0.6672) / hsa-miR-676-5p (RPM: 0.0914) / hsa-miR-143-3p (RPM: 93089.5152) / hsa-miR-3135b (RPM: 0.0038) / hsa-miR-5698 (RPM: 0.003) / hsa-miR-3652 (RPM: 0.0324) / hsa-miR-4708-5p (RPM: 0.027) / hsa-miR-5571-3p (RPM: 0.0016) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-744-3p (RPM: 3.4814) / hsa-miR-4423-5p (RPM: 0.3674) / hsa-miR-1264 (RPM: 0.7766) / hsa-miR-628-3p (RPM: 10.2162) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-1285-5p (RPM: 0.6244) / hsa-miR-3680-5p (RPM: 0.01) / hsa-miR-3692-3p (RPM: 0.0008) / hsa-miR-143-5p (RPM: 18.0714) / hsa-miR-384 (RPM: 0.015) / hsa-miR-4436b-5p (RPM: 0.0032) / hsa-miR-6514-5p (RPM: 0.4794) / hsa-miR-6088 (RPM: 0.0062) / hsa-miR-504-3p (RPM: 0.16) / hsa-miR-6890-3p (RPM: 0.0048) / hsa-miR-6501-5p (RPM: 0.0094) / hsa-miR-6509-3p (RPM: 0.0334) / hsa-miR-7975 (RPM: 0.0346) / hsa-miR-6777-3p (RPM: 0.0708) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Retinol metabolism / Vitamin digestion and absorption /
Sequence
ATGAAGAACCCCATGCTGGAGGTGGTGTCTTTACTACTGGAGAAGCTGCTCCTCATCTCCAACTTCACGCTCTTTAGTTCGGGCGCCGCGGGCGAAGACAAAGGGAGGAACAGTTTTTATGAAACCAGCTCTTTCCACCGAGGCGACGTGCTGGAGGTGCCCCGGACCCACCTGACCCACTATGGCATCTACCTAGGAGACAACCGTGTTGCCCACATGATGCCCGACATCCTGTTGGCCCTGACAGACGACATGGGGCGCACGCAGAAGGTGGTCTCCAACAAGCGTCTCATCCTGGGCGTTATTGTCAAAGTGGCCAGCATCCGCGTGGACACAGTGGAGGACTTCGCCTACGGAGCTAACATCCTGGTCAATCACCTGGACGAGTCCCTCCAGAAAAAGGCACTGCTCAACGAGGAGGTGGCGCGGAGGGCTGAAAAGCTGCTGGGCTTTACCCCCTACAGCCTGCTGTGGAACAACTGCGAGCACTTCGTGACCTACTGCAGATATGGCACCCCGATCAGTCCCCAGTCCGACAAGTTTTGTGAGACTGTGAAGATAATTATTCGTGATCAGAGAAGTGTTCTTGCTTCAGCAGTCTTGGGATTGGCGTCTATAGTCTGTACGGGCTTGGTATCATACACTACCCTTCCTGCAATTTTTATTCCATTCTTCCTATGGATGGCTGGCTAA

Back to List