Details for gene: CROCC


centrosome cycle : The cell cycle process in which centrosome duplication and separation takes place. The centrosome cycle can operate with a considerable degree of independence from other processes of the cell cycle. ; ciliary rootlet : A cytoskeleton-like structure, originating from the basal body at the proximal end of a cilium, and extending proximally toward the cell nucleus. Rootlets are typically 80-100 nm in diameter and contain cross striae distributed at regular intervals of approximately 55-70 nm. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; centriole : A cellular organelle, found close to the nucleus in many eukaryotic cells, consisting of a small cylinder with microtubular walls, 300-500 nm long and 150-250 nm in diameter. It contains nine short, parallel, peripheral microtubular fibrils, each fibril consisting of one complete microtubule fused to two incomplete microtubules. Cells usually have two centrioles, lying at right angles to each other. At division, each pair of centrioles generates another pair and the twin pairs form the pole of the mitotic spindle. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ; actin cytoskeleton : The part of the cytoskeleton (the internal framework of a cell) composed of actin and associated proteins. Includes actin cytoskeleton-associated complexes. ; cell cycle : The progression of biochemical and morphological phases and events that occur in a cell during successive cell replication or nuclear replication events. Canonically, the cell cycle comprises the replication and segregation of genetic material followed by the division of the cell, but in endocycles or syncytial cells nuclear replication or nuclear division may not be followed by cell division. ; cell projection organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a prolongation or process extending from a cell, e.g. a flagellum or axon. ; microtubule organizing center : An intracellular structure that can catalyze gamma-tubulin-dependent microtubule nucleation and that can anchor microtubules by interacting with their minus ends, plus ends or sides. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; structural molecule activity : The action of a molecule that contributes to the structural integrity of a complex or its assembly within or outside a cell. ; extracellular exosome : A vesicle that is released into the extracellular region by fusion of the limiting endosomal membrane of a multivesicular body with the plasma membrane. Extracellular exosomes, also simply called exosomes, have a diameter of about 40-100 nm. ; protein localization : Any process in which a protein is transported to, or maintained in, a specific location. ; kinesin binding : Interacting selectively and non-covalently and stoichiometrically with kinesin, a member of a superfamily of microtubule-based motor proteins that perform force-generating tasks such as organelle transport and chromosome segregation. ; positive regulation of cilium assembly : Any process that activates or increases the frequency, rate or extent of the formation of a cilium. ; positive regulation of protein localization to cilium : Any process that activates or increases the frequency, rate or extent of protein localization to cilium. ; protein localization to organelle : A process in which a protein is transported to, or maintained in, a location within an organelle. ; centriole-centriole cohesion : The cell cycle process in which the two centrioles within a centrosome remain tightly paired. ; actin binding : Interacting selectively and non-covalently with monomeric or multimeric forms of actin, including actin filaments. ; structural constituent of cytoskeleton : The action of a molecule that contributes to the structural integrity of a cytoskeletal structure. ; epithelial structure maintenance : A tissue homeostatic process required for the maintenance of epithelial structure. ; ciliary basal body organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a ciliary basal body, a short cylindrical array of microtubules and associated proteins found at the base of a eukaryotic cilium (also called flagellum). ; photoreceptor cell maintenance : Any process preventing the degeneration of the photoreceptor, a specialized cell type that is sensitive to light. ; establishment of organelle localization : The directed movement of an organelle to a specific location. ; photoreceptor inner segment : The inner segment of a vertebrate photoreceptor containing mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ; 9+2 motile cilium : A motile cilium where the axoneme has a ring of nine outer microtubule doublets plus two central microtubules (and is therefore called a 9+2 axoneme). ; subapical part of cell : The region of a polarized cell that is just below the apical region. For example, in a polarized epithelial cell, the apical region has an exposed surface and lies opposite to the basal lamina that separates the epithelium from other tissue so the subapical region is further from the exposed surface and closer to the basal lamina. ;


Symbol
CROCC
Name
ciliary rootlet coiled-coil, rootletin
Entrez ID
9696
Ensembl ID
ENSG00000058453    (more details)
KEGG ID
hsa:9696    (more details)
OMIM ID
615776
Uniprot ID
Q5TZA2  
GO ID
hsa:9696    (more details)
Chromosome
10
Strand
1
Start
84230666
End
84259960
miRNA Interactions
hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-330-5p (RPM: 48.9814) / hsa-miR-326 (RPM: 10.9272) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGAGCTTGGGGCTGGCGGGGGCACAGGAGGTGGAGCTGACACTAGAGACGGTTATCCAGACACTGGAGAGCAGCGTCCTGTGCCAGGAGAAAGGCTTGGGCGCGCGGGACCTGGCCCAGGACGCTCAGATCACCAGCCTGCCTGCCCTTATCAGGGAGATTGTCACCCGCAACCTCTCCCAGCCTGAGAGCCCAGTCCTGCTGCCGGCCACAGAGATGGCATCGCTGCTGTCGCTGCAGGAGGAGAACCAGCTGCTGCAGCAGGAGCTGTCCCGCGTGGAGGACCTGCTGGCCCAGAGCCGTGCCGAGCGCGATGAGCTCGCCATTAAGTACAATGCGGTCAGCGAGAGGCTGGAGCAGGCTCTGCGGCTGGAGCCTGGGGAGCTGGAGACGCAGGAGCCCAGGGGGCTGGTACGGCAGAGCGTGGAGTTGCGGAGGCAGCTGCAGGAGGAGCAGGCCTCCTACCGGCGCAAGCTGCAGGCCTACCAGGAGGGCCAGCAGCGGCAGGCCCAGCTTGTGCAGCGGCTGCAGGGCAAGATTCTCCAGTACAAGAAGAGGTGCTCGGAGCTGGAGCAGCAGCTGCTGGAGAGATCCGGAGAGCTGGAGCAGCAGCGGCTGAGGGACACAGAGCACAGCCAAGACCTGGAAAGCGCCCTCATCCGGCTGGAGGAGGAGCAGCAGAGGAGTGCCAGCCTGGCCCAGGTGAATGCCATGCTCCGAGAACAGCTGGACCAGGCAGGCTCGGCCAACCAGGCTCTGAGTGAGGACATACGAAAGGTGACCAATGACTGGACACGCTGCCGCAAGGAGCTGGAGCACCGGGAGGCGGCGTGGAGGCGCGAGGAGGAGTCCTTCAACGCCTACTTCAGCAACGAGCACAGTCGCCTGCTCCTCCTCTGGAGGCAGGTGGTGGGGTTCCGGCGGCTGGTCAGCGAGGTGAAGATGTTCACTGAGAGGGACCTGCTGCAGCTGGGAGGGGAGCTGGCCCGGACATCACGAGCTGTCCAGGAGGCGGGCCTGGGACTGAGCACGGGCCTACGGCTGGCAGAGAGCCGGGCCGAGGCAGCCCTGGAGAAACAGGCCCTGCTGCAGGCCCAGCTGGAGGAGCAGCTGCGGGACAAGGTGCTCCGCGAGAAGGACCTGGCGCAGCAGCAGATGCAAAGCGACCTGGACAAGGCTGACCTCAGTGCCAGAGTGACAGAGCTGGGCCTGGCAGTGAAGCGTCTTGAGAAGCAGAATCTGGAGAAGGATCAGGTCAACAAGGACCTCACTGAGAAGCTTGAGGCCCTGGAATCCCTGCGGCTACAGGAGCAGGCGGCCCTGGAGACAGAGGATGGAGAGGGGCTACAGCAGACCCTAAGGGACCTGGCACAGGCCGTCTTGTCAGACTCTGAGAGCGGCGTCCAGCTGAGCGGCTCTGAGCGCACCGCGGATGCTTCCAACGGCAGCCTGCGGGGGCTCTCGGGCCAGCGGACCCCGTCCCCACCGCGGCGCTCCTCGCCCGGCCGAGGCCGTTCACCCCGCCGAGGCCCCTCCCCGGCCTGCTCAGACTCCTCCACGCTCGCCCTGATCCACTCCGCCCTGCACAAGCGCCAGCTGCAGGTCCAGGACATGCGTGGGCGCTATGAGGCAAGCCAGGACCTACTGGGCACCCTGCGGAAGCAGCTTAGCGACAGCGAGAGCGAGCGGCGGGCCCTAGAGGAACAGCTGCAGCGCCTGCGGGACAAGACCGACGGCGCCATGCAGGCCCACGAGGACGCCCAGCGCGAGGTGCAGCGGCTGCGGAGCGCCAACGAGCTCCTGAGCAGGGAGAAGAGCAACCTGGCCCACAGCCTGCAGGTGGCCCAGCAGCAGGCCGAGGAGCTGCGGCAGGAGCGGGAGAAGCTGCAGGCTGCCCAGGAGGAGCTGCGGCGCCAGCGGGACCGGCTGGAGGAAGAGCAGGAGGACGCAGTGCAGGATGGCGCGCGGGTGCGCCGGGAGCTTGAGCGCAGCCATAGACAACTAGAGCAGCTGGAAGGGAAGCGCTCAGTCCTGGCCAAGGAGCTGGTGGAGGTGAGGGAGGCGCTGAGCCGCGCCACACTGCAACGGGACATGCTGCAGGCCGAGAAGGCCGAGGTGGCCGAGGCGCTGACCAAGGCTGAGGCTGGCCGCGTGGAGCTCGAGCTCTCCATGACCAAGCTGAGGGCAGAGGAGGCCTCCCTGCAGGACTCCCTGTCCAAGCTGAGCGCCCTCAACGAGAGCCTTGCTCAGGACAAGTTGGATCTGAACCGCCTTGTCGCCCAGCTGGAGGAAGAAAAGTCCGCCCTGCAGGGCCGGCAACGGCAGGCAGAGCAGGAGGCCACAGTGGCGCGGGAAGAGCAGGAACGGCTAGAGGAGCTGCGGTTGGAGCAGGAGGTGGCGCGGCAGGGCCTGGAGGGCTCCCTACGAGTGGCGGAGCAGGCCCAGGAGGCATTGGAGCAGCAGCTCCCCACGCTGCGCCATGAGCGCAGCCAGCTGCAGGAGCAGCTAGCGCAGCTCTCCCGGCAGCTGAGCGGGCGGGAGCAGGAGCTGGAGCAGGCCCGGCGGGAGGCCCAGCGGCAAGTGGAGGCGCTGGAGCGAGCGGCCCGTGAGAAGGAGGCGCTAGCCAAGGAGCACGCTGGCCTGGCTGTGCAGCTGGTGGCTGCGGAGCGTGAAGGCAGGACCCTGTCAGAGGAGGCCACACGCCTGCGCTTGGAGAAGGAAGCCCTGGAGGGCAGCCTGTTTGAGGTGCAACGGCAGCTGGCCCAGCTTGAGGCCCGCCGGGAGCAGCTGGAAGCCGAGGGGCAGGCCCTGCTGCTGGCCAAGGAGACCCTGACTGGGGAGTTGGCGGGCCTGCGGCAGCAAATAATAGCTACACAGGAGAAAGCCAGTCTAGACAAGGAGCTGATGGCCCAGAAGCTGGTGCAGGCTGAGCGGGAGGCCCAGGCCTCTCTGCGGGAGCAGCGGGCAGCTCACGAGGAGGACTTACAGCGACTCCAGCGTGAAAAGGAGGCAGCATGGCGGGAGCTGGAGGCCGAGCGGGCCCAGCTGCAGAGTCAGCTGCAGCGTGAGCAGGAGGAGCTGCTGGCCCGGCTGGAGGCTGAGAAGGAAGAGCTGAGTGAGGAGATTGCTGCCCTGCAGCAGGAGCGCGACGAGGGCCTCCTCCTAGCAGAGAGTGAGAAGCAGCAGGCCTTGTCTCTGAAGGAGTCTGAGAAGACGGCGCTGTCAGAGAAGTTGATGGGTACACGGCACAGCCTGGCCACCATCTCCCTGGAGATGGAGCGGCAGAAACGAGATGCCCAGAGCCGGCAGGAGCAGGACCGGAGCACCGTGAACGCTCTGACGTCTGAGCTGCGGGACCTACGGGCCCAGCGGGAGGAGGCTGCTGCGGCCCACGCCCAGGAGGTGAGGAGGCTGCAAGAGCAGGCCCGAGACCTGGGCAAGCAGCGGGACTCCTGTCTTCGCGAGGCAGAAGAGCTTCGGACCCAGCTGCGTCTGCTGGAGGATGCCCGTGACGGGCTGCGGCGGGAGCTGCTGGAGGCCCAGCGCAAGCTGCGTGAGAGCCAGGAGGGCCGGGAGGTGCAGCGCCAGGAGGCAGGCGAGCTGCGACGCAGCCTGGGCGAGGGTGCCAAGGAGCGCGAGGCCCTGCGGCGTTCCAATGAGGAGCTTCGGTCTGCTGTGAAGAAGGCAGAGAGCGAGCGCATCAGCCTGAAGCTTGCCAATGAGGACAAGGAGCAGAAGCTGGCACTCCTAGAGGAGGCACGGACAGCTGTGGGCAAGGAGGCCGGGGAGCTGCGAACTGGGCTGCAGGAGGTGGAGCGCTCACGGCTGGAGGCTCGGCGGGAGCTGCAGGAGCTCCGGCGTCAGATGAAGATGCTGGACAGTGAGAACACCAGACTGGGCCGGGAGCTGGCGGAGCTGCAGGGCCGCCTGGCGCTGGGCGAGCGGGCAGAGAAGGAGAGCAGGCGGGAGACCCTGGGCCTCCGGCAGAGGCTGCTGAAGGGCGAGGCCAGCCTGGAGGTGATGCGGCAGGAGCTCCAGGTAGCCCAGCGGAAGCTGCAGGAACAAGAAGGCGAGTTCCGGACCCGCGAGCGACGCCTGCTGGGCTCCCTGGAGGAGGCGCGTGGCACTGAAAAGCAGCAGCTGGACCACGCCCGCGGCCTGGAGCTGAAGCTGGAGGCGGCGCGGGCCGAGGCTGCAGAGCTGGGCCTGCGGCTGAGCGCAGCCGAGGGCCGGGCACAAGGCCTGGAGGCCGAGCTGGCCCGCGTGGAGGTGCAGCGGCGCGCGGCGGAGGCCCAGCTGGGTGGCCTGCGCTCGGCTCTGCGCCGGGGCCTCGGCCTCGGTCGCGCGCCCAGCCCAGCCCCGCGGCCAGTGCCCGGTTCCCCTGCCCGGGACGCACCCGCAGAAGGAAGCGGGGAAGGGCTCAACAGCCCCAGCACCTTAGAATGCAGCCCTGGGTCCCAGCCACCATCTCCAGGACCTGCCACCTCCCCAGCCTCTCCAGACCTGGACCCGGAGGCAGTGCGCGGGGCCCTCCGGGAATTCCTGCAAGAGCTGCGGAGTGCCCAGAGAGAACGGGACGAACTTCGGACCCAGACCAGTGCCCTGAATCGCCAGCTGGCCGAGATGGAGGCTGAGAGGGACAGCGCAACCTCGAGGGCCAGGCAGCTGCAGAAGGCGGTGGCTGAGAGTGAGGAAGCCCGGCGCAGTGTGGATGGGCGGCTGAGCGGGGTCCAGGCGGAGCTGGCGCTGCAGGAGGAGAGTGTGCGGCGCAGTGAGCGGGAGCGCCGGGCCACGCTGGACCAGGTGGCCACACTGGAGAGGAGCCTGCAGGCCACCGAGAGCGAGCTCCGGGCCAGCCAGGAGAAGATCAGCAAGATGAAGGCCAATGAGACAAAGCTGGAGGGCGACAAGCGGCGCCTGAAGGAGGTTCTGGACGCCTCCGAGAGCCGCACTGTCAAGCTGGAGCTGCAGCGGCGCTCGCTTGAGGGGGAGCTGCAGCGCAGCCGCCTGGGCCTCAGTGACCGCGAGGCCCAAGCCCAGGCCCTCCAGGATCGGGTGGATTCCCTGCAGAGACAGGTGGCCGACAGCGAGGTGAAGGCAGGGACCCTGCAGCTGACCGTGGAGCGGCTGAATGGGGCCCTGGCTAAGGTGGAGGAAAGCGAGGGGGCCCTGCGGGACAAGGTGCGGGGCCTGACAGAGGCCCTGGCCCAGAGCAGTGCCAGCCTCAACAGCACCCGGGACAAGAACCTGCATCTGCAGAAGGCTCTGACCGCCTGTGAACATGACCGCCAAGTACTCCAGGAACGGCTGGATGCCGCCCGGCAGGCATTATCTGAGGCACGGAAGCAGAGCAGCTCCCTGGGCGAGCAGGTGCAGACGTTGCGAGGCGAGGTGGCTGACCTGGAACTGCAGCGGGTGGAGGCCGAGGGCCAGCTACAACAGCTACGGGAGGTGCTGCGGCAGCGGCAGGAGGGTGAGGCTGCAGCCCTGAACACCGTCCAGAAGCTGCAAGACGAGCGGCGGCTGCTGCAGGAGCGCCTGGGAAGCCTGCAGCGCGCCCTGGCTCAGCTGGAAGCTGAGAAGCGGGAGGTGGAGCGCTCAGCCCTGCGGCTGGAGAAGGACCGTGTAGCCCTCAGGAGGACGCTGGACAAGGTGGAGCGGGAGAAGCTTCGTAGCCATGAGGACACAGTGCGGCTGAGCGCAGAGAAGGGCCGCCTGGACCGCACCCTCACGGGGGCTGAGCTGGAGCTGGCAGAGGCGCAGAGGCAGATCCAGCAGCTGGAGGCGCAGGTGGTGGTGCTGGAGCAGAGCCACAGCCCGGCCCAGCTGGAGGTGGATGCGCAGCAGCAGCAGCTGGAGCTGCAGCAGGAGGTGGAGCGGCTGCGCAGCGCCCAGGCGCAGACTGAGCGCACCCTGGAGGCTCGGGAGCGGGCCCACCGCCAGAGGGTGCGTGGGCTGGAGGAGCAGGTGTCCACACTGAAGGGCCAGCTGCAGCAGGAGCTTCGAAGGAGCTCAGCACCCTTCTCCCCACCCTCCGGCCCCCCAGAGAAATGA

Back to List