Details for gene: IFT140


cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; cilium assembly : The assembly of a cilium, a specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface. Each cilium is bounded by an extrusion of the cytoplasmic membrane, and contains a regular longitudinal array of microtubules, anchored basally in a centriole. ; cell projection organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a prolongation or process extending from a cell, e.g. a flagellum or axon. ; microtubule organizing center : An intracellular structure that can catalyze gamma-tubulin-dependent microtubule nucleation and that can anchor microtubules by interacting with their minus ends, plus ends or sides. ; centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ; axoneme : The bundle of microtubules and associated proteins that forms the core of cilia (also called flagella) in eukaryotic cells and is responsible for their movements. ; ciliary basal body : A membrane-tethered, short cylindrical array of microtubules and associated proteins found at the base of a eukaryotic cilium (also called flagellum) that is similar in structure to a centriole and derives from it. The cilium basal body is the site of assembly and remodelling of the cilium and serves as a nucleation site for axoneme growth. As well as anchoring the cilium, it is thought to provide a selective gateway regulating the entry of ciliary proteins and vesicles by intraflagellar transport. ; protein localization to cilium : A process in which a protein is transported to, or maintained in, a location within a cilium. ; ciliary tip : Part of the cilium where the axoneme ends. The ciliary tip has been implicated in ciliary assembly and disassembly, as well as signal transduction. ; molecular_function : A molecular process that can be carried out by the action of a single macromolecular machine, usually via direct physical interactions with other molecular entities. Function in this sense denotes an action, or activity, that a gene product (or a complex) performs. These actions are described from two distinct but related perspectives: (1) biochemical activity, and (2) role as a component in a larger system/process. ; regulation of cilium assembly : Any process that modulates the frequency, rate or extent of cilium assembly. ; intraciliary transport : The bidirectional movement of large protein complexes along microtubules within a cilium, mediated by motor proteins. ; intraciliary retrograde transport : The directed movement of large protein complexes along microtubules from the tip of a cilium (also called flagellum) toward the cell body, mediated by motor proteins. ; intraciliary transport particle A : The smaller subcomplex of the intraciliary transport particle; characterized complexes have molecular weights of 710-760 kDa. ; determination of left/right symmetry : The establishment of an organism's body plan or part of an organism with respect to the left and right halves. The pattern can either be symmetric, such that the halves are mirror images, or asymmetric where the pattern deviates from this symmetry. ; heart development : The process whose specific outcome is the progression of the heart over time, from its formation to the mature structure. The heart is a hollow, muscular organ, which, by contracting rhythmically, keeps up the circulation of the blood. ; regulation of smoothened signaling pathway : Any process that modulates the frequency, rate or extent of smoothened signaling. ; neural tube patterning : The regionalization process that regulates the coordinated growth that establishes the non-random spatial arrangement of the neural tube. ; embryonic camera-type eye development : The process occurring during the embryonic phase whose specific outcome is the progression of the eye over time, from its formation to the mature structure. ; limb morphogenesis : The process in which the anatomical structures of a limb are generated and organized. A limb is a paired appendage of a tetrapod used for locomotion or grasping. ; photoreceptor cell outer segment organization : A process that is carried out at the cellular level and results in the assembly, arrangement of constituent parts, or disassembly of the outer segment of a photoreceptor cell, a sensory cell that reacts to the presence of light. The outer segment of the photoreceptor cell contains the light-absorbing materials. ; embryonic digit morphogenesis : The process, occurring in the embryo, by which the anatomical structures of the digit are generated and organized. A digit is one of the terminal divisions of an appendage, such as a finger or toe. ; embryonic cranial skeleton morphogenesis : The process in which the anatomical structures of the cranial skeleton are generated and organized during the embryonic phase. ; non-motile cilium assembly : The aggregation, arrangement and bonding together of a set of components to form a non-motile cilium. ; embryonic brain development : The process occurring during the embryonic phase whose specific outcome is the progression of the brain over time, from its formation to the mature structure. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; centriole : A cellular organelle, found close to the nucleus in many eukaryotic cells, consisting of a small cylinder with microtubular walls, 300-500 nm long and 150-250 nm in diameter. It contains nine short, parallel, peripheral microtubular fibrils, each fibril consisting of one complete microtubule fused to two incomplete microtubules. Cells usually have two centrioles, lying at right angles to each other. At division, each pair of centrioles generates another pair and the twin pairs form the pole of the mitotic spindle. ; photoreceptor connecting cilium : The portion of the photoreceptor cell cilium linking the photoreceptor inner and outer segments. It's considered to be equivalent to the ciliary transition zone. ; non-motile cilium : A cilium which may have a variable array of axonemal microtubules but does not contain molecular motors. ;


Symbol
IFT140
Name
intraflagellar transport 140
Entrez ID
9742
Ensembl ID
ENSG00000187535    (more details)
KEGG ID
hsa:9742    (more details)
OMIM ID
266920
Uniprot ID
Q96RY7  
GO ID
hsa:9742    (more details)
Chromosome
3
Strand
-1
Start
129528639
End
129535344
miRNA Interactions
hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-181b-3p (RPM: 2.493) / hsa-miR-196b-5p (RPM: 0.2478) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-93-3p (RPM: 9.5402) / hsa-miR-3681-5p (RPM: 0.9468) / hsa-miR-6874-5p (RPM: 0.0102) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Intraflagellar transport / Hedgehog 'off' state /
Sequence
ATGGCCCTCTATTATGACCACCAGATAGAAGCCCCGGATGCAGCAGGGTCACCCTCATTTATCAGCTGGCACCCTGTCCATCCATTCTTGGCAGTTGCTTACATCAGCACAACCTCAACAGGCAGCGTGGATATTTACCTGGAGCAAGGGGAGTGCGTGCCAGATACACACGTCGAGAGGCCGTTCCGGGTTGCTTCCCTGTGCTGGCACCCGACGCGGCTGGTGCTGGCTGTGGGCTGGGAGACTGGAGAAGTGACGGTGTTTAACAAGCAGGACAAGGAGCAGCACACGATGCCCCTGACACACACAGCCGACATCACCGTGCTCCGTTGGAGCCCCAGTGGAAACTGCCTGCTGTCTGGGGACAGGCTTGGTGTCTTGCTCTTGTGGAGGTTGGACCAAAGGGGCCGAGTGCAAGGGACGCCTCTGCTGAAACACGAGTATGGGAAACACCTCACGCACTGCATCTTCCGGCTCCCCCCTCCTGGCGAGGACCTGGTTCAGTTGGCAAAGGCAGCTGTGAGCGGTGATGAGAAAGCCCTGGACATGTTTAACTGGAAGAAGAGCAGTTCTGGAAGTTTGCTGAAGATGGGGTCTCACGAGGGGCTGTTGTTCTTTGTCAGTCTGATGGACGGGACAGTGCACTATGTGGATGAGAAGGGCAAGACCACTCAGGTGGTGTCCGCAGACAGCACGATTCAGATGCTGTTCTACATGGAGAAGAGGGAGGCACTGGTGGTGGTCACAGAGAACCTCCGGCTGTCCCTGTACACGGTGCCTCCTGAGGGCAAAGCAGAAGAAGTGATGAAGGTCAAGCTGAGCGGGAAAACCGGCCGCCGGGCAGACATCGCTTTGATTGAAGGCAGCCTTCTCGTGATGGCCGTCGGGGAGGCTGCCCTCAGATTCTGGGACATAGAACGAGGAGAGAATTATATACTGAGTCCAGATGAGAAGTTTGGCTTTGAGAAAGGAGAGAATATGAACTGTGTGTGTTACTGTAAAGTCAAAGGTCTTCTGGCCGCTGGTACCGACAGAGGGCGAGTAGCCATGTGGAGGAAAGTACCAGACTTCCTGGGCAGCCCCGGGGCAGAGGGCAAGGACAGGTGGGCCCTTCAGACCCCTACCGAGCTCCAAGGAAACATCACGCAAATCCAGTGGGGTTCCAGGAAGAACCTGCTGGCAGTGAACAGCGTCATCTCCGTGGCCATCCTCAGCGAGCGGGCCATGTCGTCACACTTCCACCAGCAAGTGGCCGCCATGCAGGTCTCCCCGAGTCTGCTGAATGTGTGCTTCCTGTCCACGGGGGTCGCACACAGCCTGCGCACCGACATGCACATCAGTGGAGTGTTTGCCACCAAGGATGCTGTCGCAGTCTGGAACGGAAGGCAGGTGGCGATCTTCGAGCTTTCTGGAGCCGCGATACGGAGTGCAGGGACCTTCTTGTGTGAGACGCCTGTGTTAGCAATGCATGAAGAAAACGTTTACACGGTGGAGTCAAACCGAGTTCAAGTTCGAACCTGGCAGGGGACTGTCAAACAACTCCTCCTTTTCTCGGAGACTGAGGGGAATCCCTGCTTCTTGGACATCTGTGGGAATTTCCTGGTTGTAGGGACAGACTTGGCTCACTTTAAAAGCTTTGATCTTTCCCGAAGAGAGGCCAAAGCACACTGTAGCTGCAGGAGCCTGGCGGAGCTGGTCCCTGGGGTGGGGGGCATCGCTTCTCTGCGGTGCAGCAGCAGCGGGAGCACCATCAGCATCCTCCCCAGCAAGGCTGACAACAGCCCTGATTCCAAAATCTGCTTCTACGATGTTGAAATGGACACAGTGACCGTCTTTGACTTCAAGACTGGACAAATTGATCGGAGAGAGACGCTGTCCTTTAATGAGCAAGAGACTAATAAGAGCCACCTCTTTGTGGATGAGGGACTGAAAAATTATGTTCCCGTGAACCACTTCTGGGACCAGAGTGAGCCCCGGCTGTTTGTATGCGAAGCCGTGCAGGAGACGCCGCGCTCCCAGCCTCAGTCTGCAAACGGGCAGCCCCAAGATGGGCGCGCTGGCCCTGCGGCAGATGTTTTGATCCTGTCCTTCTTCATTTCCGAAGAGCACGGCTTCCTGCTTCATGAGAGCTTCCCCCGGCCTGCCACCTCCCACAGTCTCCTGGGGATGGAAGTGCCTTATTACTACTTCACAAGAAAGCCCGAAGAAGCAGACAGAGAAGACGAGGTGGAGCCTGGGTGCCACCACATCCCTCAGATGGTGTCCAGGAGACCCCTGCGAGACTTTGTGGGGCTGGAGGACTGCGACAAGGCCACCCGGGACGCCATGCTCCACTTCAGCTTCTTTGTCACCATAGGAGACATGGACGAAGCCTTCAAATCCATCAAGCTCATCAAAAGTGAGGCCGTCTGGGAGAACATGGCGCGCATGTGCGTGAAGACCCAGCGGCTGGACGTGGCCAAGGTGTGCCTGGGGAACATGGGCCATGCCCGCGGGGCCCGAGCGCTGCGTGAGGCGGAGCAGGAGCCGGAGCTAGAGGCCCGCGTGGCCGTGCTGGCCACGCAGCTGGGCATGCTGGAGGACGCCGAGCAGCTGTACAGGAAGTGCAAGCGCCACGACCTCCTGAACAAGTTCTACCAGGCTGCGGGCCGGTGGCAGGAGGCCCTCCAGGTAGCCGAGCACCACGATCGCGTGCACCTGCGCAGCACCTACCACCGCTATGCCGGGCACCTGGAGGCCAGCGCCGACTGCAGCCGGGCCCTCAGTTACTACGAGAAGTCGGACACGCACCGCTTCGAGGTGCCCAGGATGCTGTCGGAGGACCTGCCGTCCCTGGAGCTCTACGTGAATAAAATGAAGGATAAGACCCTGTGGCGGTGGTGGGCGCAGTACCTGGAGAGCCAGGGCGAGATGGACGCCGCGCTGCACTACTACGAGCTGGCCCGGGACCACTTCTCCCTGGTCCGCATCCACTGCTTCCAGGGCAATGTCCAGAAGGCTGCGCAAATAGCCAACGAGACAGGAAACCTGGCGGCCTCCTACCACCTCGCCCGCCAGTACGAGAGCCAGGAGGAGGTCGGGCAGGCGGTGCACTTCTACACCCGGGCACAGGCCTTCAAGAATGCCATCCGCCTGTGCAAGGAGAACGGCCTGGACGACCAGCTCATGAACTTGGCCCTGCTGAGCTCCCCCGAGGACATGATCGAGGCGGCCCGATACTACGAGGAGAAGGGCGTGCAGATGGACAGGGCGGTCATGCTGTACCACAAGGCTGGCCACTTCTCCAAGGCCCTGGAGCTGGCCTTTGCCACCCAGCAGTTTGTGGCCCTACAGCTCATAGCAGAGGACCTGGATGAGACGTCAGACCCTGCGCTCCTGGCCCGCTGCTCCGACTTCTTCATCGAGCACAGTCAGTACGAGAGGGCGGTAGAGCTGCTGCTGGCTGCCAGGAAGTATCAGGAAGCCCTGCAGCTGTGCCTGGGGCAGAACATGAGCATCACCGAGGAGATGGCGGAAAAGATGACCGTGGCCAAGGACTCCTCGGACCTGCCTGAGGAGTCGCGGCGGGAGCTGCTGGAGCAGATAGCAGACTGCTGCATGCGCCAGGGCAGCTACCACCTGGCCACCAAGAAGTACACGCAGGCCGGCAACAAGCTGAAGGCCATGAGGGCGCTGCTCAAATCCGGAGACACGGAGAAAATCACGTTCTTCGCGAGCGTGTCCAGGCAGAAGGAAATCTACATCATGGCTGCTAACTACCTGCAGTCCCTGGACTGGCGGAAGGAGCCGGAGATCATGAAGAACATCATCGGCTTCTACACCAAGGGGCGGGCCCTGGACCTCCTGGCTGGCTTTTATGACGCTTGTGCCCAGGTGGAGATTGATGAATACCAGAACTACGACAAAGCCCACGGGGCGCTGACCGAGGCCTACAAGTGCCTGGCCAAGGCCAAGGCCAAGAGCCCCCTGGACCAGGAGACCAGGCTGGCGCAGCTGCAGAGCAGGATGGCACTGGTGAAGAGGTTCATCCAGGCCCGCAGGACGTACACAGAGGACCCCAAGGAGTCCATCAAGCAGTGTGAGCTGCTCCTGGAGGAACCAGACCTGGACAGCACCATCCGCATCGGGGACGTCTATGGCTTCCTGGTGGAGCACTACGTGCGGAAGGAGGAATACCAGACGGCCTACAGATTCCTGGAGGAGATGCGGCGGCGGCTTCCCTTGGCCAACATGTCCTACTACGTGAGCCCGCAGGCCGTGGACGCCGTGCACCGGGGGCTGGGTCTCCCACTGCCACGCACCGTCCCCGAGCAGGTCCGCCACAACAGCATGGAGGACGCCAGGGAGCTGGACGAGGAGGTGGTGGAAGAGGCAGATGACGACCCCTGA

Back to List