Details for gene: NR2E3


zinc ion binding : Interacting selectively and non-covalently with zinc (Zn) ions. ; regulation of transcription, DNA-templated : Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription. ; DNA-binding transcription factor activity : A transcription regulator activity that modulates transcription of gene sets via selective and non-covalent binding to a specific double-stranded genomic DNA sequence (sometimes referred to as a motif) within a cis-regulatory region. Regulatory regions include promoters (proximal and distal) and enhancers. Genes are transcriptional units, and include bacterial operons. ; sequence-specific DNA binding : Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; cellular process : Any process that is carried out at the cellular level, but not necessarily restricted to a single cell. For example, cell communication occurs among more than one cell, but occurs at the cellular level. ; DNA binding : Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid). ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; steroid hormone receptor activity : Combining with a steroid hormone and transmitting the signal within the cell to initiate a change in cell activity or function. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; intracellular receptor signaling pathway : Any series of molecular signals initiated by a ligand binding to an receptor located within a cell. ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; steroid hormone mediated signaling pathway : A series of molecular signals mediated by a steroid hormone binding to a receptor. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; regulation of transcription by RNA polymerase II : Any process that modulates the frequency, rate or extent of transcription mediated by RNA polymerase II. ; negative regulation of transcription by RNA polymerase II : Any process that stops, prevents, or reduces the frequency, rate or extent of transcription mediated by RNA polymerase II. ; RNA polymerase II cis-regulatory region sequence-specific DNA binding : Interacting selectively and non-covalently with a specific upstream regulatory DNA sequence (transcription factor recognition sequence or binding site) located in cis relative to the transcription start site (i.e., on the same strand of DNA) of a gene transcribed by RNA polymerase II. ; nuclear receptor activity : A DNA-binding transcription factor activity regulated by binding to a ligand that modulates the transcription of specific gene sets transcribed by RNA polymerase II. Nuclear receptor ligands are usually lipid-based (such as a steroid hormone) and the binding of the ligand to its receptor often occurs in the cytoplasm, which leads to its tranlocation to the nucleus. ; cell differentiation : The process in which relatively unspecialized cells, e.g. embryonic or regenerative cells, acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. Differentiation includes the processes involved in commitment of a cell to a specific fate and its subsequent development to the mature state. ; positive regulation of transcription by RNA polymerase II : Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter. ; DNA-binding transcription activator activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that activates or increases transcription of specific gene sets transcribed by RNA polymerase II. ; anatomical structure development : The biological process whose specific outcome is the progression of an anatomical structure from an initial condition to its mature state. This process begins with the formation of the structure and ends with the mature structure, whatever form that may be including its natural destruction. An anatomical structure is any biological entity that occupies space and is distinguished from its surroundings. Anatomical structures can be macroscopic such as a carpel, or microscopic such as an acrosome. ; signal transduction : The cellular process in which a signal is conveyed to trigger a change in the activity or state of a cell. Signal transduction begins with reception of a signal (e.g. a ligand binding to a receptor or receptor activation by a stimulus such as light), or for signal transduction in the absence of ligand, signal-withdrawal or the activity of a constitutively active receptor. Signal transduction ends with regulation of a downstream cellular process, e.g. regulation of transcription or regulation of a metabolic process. Signal transduction covers signaling from receptors located on the surface of the cell and signaling via molecules located within the cell. For signaling between cells, signal transduction is restricted to events at and within the receiving cell. ; phototransduction : The sequence of reactions within a cell required to convert absorbed photons into a molecular signal. ; negative regulation of cell population proliferation : Any process that stops, prevents or reduces the rate or extent of cell proliferation. ; positive regulation of gene expression : Any process that increases the frequency, rate or extent of gene expression. Gene expression is the process in which a gene's coding sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form. ; eye photoreceptor cell development : Development of a photoreceptor, a sensory cell in the eye that reacts to the presence of light. They usually contain a pigment that undergoes a chemical change when light is absorbed, thus stimulating a nerve. ; retina development in camera-type eye : The process whose specific outcome is the progression of the retina over time, from its formation to the mature structure. The retina is the innermost layer or coating at the back of the eyeball, which is sensitive to light and in which the optic nerve terminates. ; transcription regulator complex : A protein complex that is capable of associating with DNA by direct binding, or via other DNA-binding proteins or complexes, and regulating transcription. ;


Symbol
NR2E3
Name
nuclear receptor subfamily 2 group E member 3
Entrez ID
10002
Ensembl ID
ENSG00000278570    (more details)
KEGG ID
hsa:10002    (more details)
OMIM ID
268100
Uniprot ID
Q9Y5X4  
GO ID
hsa:10002    (more details)
Chromosome
8
Strand
1
Start
54509422
End
54871720
miRNA Interactions
hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-1343-3p (RPM: 3.6608) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Nuclear Receptor transcription pathway /
Sequence
ATGGAGACCAGACCAACAGCTCTGATGAGCTCCACAGTGGCTGCAGCTGCGCCTGCAGCTGGGGCTGCCTCCAGGAAGGAGTCTCCAGGCAGATGGGGCCTGGGGGAGGATCCCACAGGCGTGAGCCCCTCGCTCCAGTGCCGCGTGTGCGGAGACAGCAGCAGCGGGAAGCACTATGGCATCTATGCCTGCAACGGCTGCAGCGGCTTCTTCAAGAGGAGCGTACGGCGGAGGCTCATCTACAGGTGCCAGGTGGGGGCAGGGATGTGCCCCGTGGACAAGGCCCACCGCAACCAGTGCCAGGCCTGCCGGCTGAAGAAGTGCCTGCAGGCGGGGATGAACCAGGACGCCGTGCAGAACGAGCGCCAGCCGCGAAGCACAGCCCAGGTCCACCTGGACAGCATGGAGTCCAACACTGAGTCCCGGCCGGAGTCCCTGGTGGCTCCCCCGGCCCCGGCAGGGCGCAGCCCACGGGGCCCCACACCCATGTCTGCAGCCAGAGCCCTGGGCCACCACTTCATGGCCAGCCTTATAACAGCTGAAACCTGTGCTAAGCTGGAGCCAGAGGATGCTGATGAGAATATTGATGTCACCAGCAATGACCCTGAGTTCCCCTCCTCTCCATACTCCTCTTCCTCCCCCTGCGGCCTGGACAGCATCCATGAGACCTCGGCTCGCCTACTCTTCATGGCCGTCAAGTGGGCCAAGAACCTGCCTGTGTTCTCCAGCCTGCCCTTCCGGGATCAGGTGATCCTGCTGGAAGAGGCGTGGAGTGAACTCTTTCTCCTCGGGGCCATCCAGTGGTCTCTGCCTCTGGACAGCTGTCCTCTGCTGGCACCGCCCGAGGCCTCTGCTGCCGGTGGTGCCCAGGGCCGGCTCACGCTGGCCAGCATGGAGACGCGTGTCCTGCAGGAAACTATCTCTCGGTTCCGGGCATTGGCGGTGGACCCCACGGAGTTTGCCTGCATGAAGGCCTTGGTCCTCTTCAAGCCAGAGACGCGGGGCCTGAAGGATCCTGAGCACGTAGAGGCCTTGCAGGACCAGTCCCAAGTGATGCTGAGCCAGCACAGCAAGGCCCACCACCCCAGCCAGCCCGTGAGGTTTGGGAAATTGCTCCTGCTCCTCCCGTCTTTGAGGTTTATCACTGCGGAACGCATCGAGCTCCTCTTTTTCCGCAAGACCATAGGGAATACTCCAATGGAGAAGCTCCTTTGTGATATGTTCAAAAACTAG

Back to List