Details for gene: TOPORS


nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; nuclear speck : A discrete extra-nucleolar subnuclear domain, 20-50 in number, in which splicing factors are seen to be localized by immunofluorescence microscopy. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; transferase activity : Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; DNA binding : Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid). ; cellular response to DNA damage stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus indicating damage to its DNA from environmental insults or errors during metabolism. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; ubiquitin-protein transferase activity : Catalysis of the transfer of ubiquitin from one protein to another via the reaction X-Ub + Y --> Y-Ub + X, where both X-Ub and Y-Ub are covalent linkages. ; ubiquitin-dependent protein catabolic process : The chemical reactions and pathways resulting in the breakdown of a protein or peptide by hydrolysis of its peptide bonds, initiated by the covalent attachment of a ubiquitin group, or multiple ubiquitin groups, to the protein. ; protein sumoylation : The process in which a SUMO protein (small ubiquitin-related modifier) is conjugated to a target protein via an isopeptide bond between the carboxy-terminus of SUMO with an epsilon-amino group of a lysine residue of the target protein. ; PML body : A class of nuclear body; they react against SP100 auto-antibodies (PML, promyelocytic leukemia); cells typically contain 10-30 PML bodies per nucleus; alterations in the localization of PML bodies occurs after viral infection. ; proteasome-mediated ubiquitin-dependent protein catabolic process : The chemical reactions and pathways resulting in the breakdown of a protein or peptide by hydrolysis of its peptide bonds, initiated by the covalent attachment of ubiquitin, and mediated by the proteasome. ; transcription, DNA-templated : The cellular synthesis of RNA on a template of DNA. ; ubiquitin protein ligase activity : Catalysis of the transfer of ubiquitin to a substrate protein via the reaction X-ubiquitin + S -> X + S-ubiquitin, where X is either an E2 or E3 enzyme, the X-ubiquitin linkage is a thioester bond, and the S-ubiquitin linkage is an amide bond: an isopeptide bond between the C-terminal glycine of ubiquitin and the epsilon-amino group of lysine residues in the substrate or, in the linear extension of ubiquitin chains, a peptide bond the between the C-terminal glycine and N-terminal methionine of ubiquitin residues. ; protein polyubiquitination : Addition of multiple ubiquitin groups to a protein, forming a ubiquitin chain. ; ciliary basal body : A membrane-tethered, short cylindrical array of microtubules and associated proteins found at the base of a eukaryotic cilium (also called flagellum) that is similar in structure to a centriole and derives from it. The cilium basal body is the site of assembly and remodelling of the cilium and serves as a nucleation site for axoneme growth. As well as anchoring the cilium, it is thought to provide a selective gateway regulating the entry of ciliary proteins and vesicles by intraflagellar transport. ; negative regulation of apoptotic process : Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process. ; SUMO transferase activity : Catalysis of the transfer of SUMO from one protein to another via the reaction X-SUMO + Y --> Y-SUMO + X, where both X-SUMO and Y-SUMO are covalent linkages. ; protein monoubiquitination : Addition of a single ubiquitin group to a protein. ; protein localization to nucleus : A process in which a protein transports or maintains the localization of another protein to the nucleus. ; antigen binding : Interacting selectively and non-covalently with an antigen, any substance which is capable of inducing a specific immune response and of reacting with the products of that response, the specific antibody or specifically sensitized T-lymphocytes, or both. Binding may counteract the biological activity of the antigen. ; positive regulation of ubiquitin-protein transferase activity : Any process that activates, maintains or increases the rate of ubiquitin transferase activity. ; centriole : A cellular organelle, found close to the nucleus in many eukaryotic cells, consisting of a small cylinder with microtubular walls, 300-500 nm long and 150-250 nm in diameter. It contains nine short, parallel, peripheral microtubular fibrils, each fibril consisting of one complete microtubule fused to two incomplete microtubules. Cells usually have two centrioles, lying at right angles to each other. At division, each pair of centrioles generates another pair and the twin pairs form the pole of the mitotic spindle. ; intrinsic apoptotic signaling pathway in response to DNA damage : A series of molecular signals in which an intracellular signal is conveyed to trigger the apoptotic death of a cell. The pathway is induced by the detection of DNA damage, and ends when the execution phase of apoptosis is triggered. ; spindle pole : Either of the ends of a spindle, where spindle microtubules are organized; usually contains a microtubule organizing center and accessory molecules, spindle microtubules and astral microtubules. ; maintenance of protein location in nucleus : Any process in which a protein is maintained in the nucleus and prevented from moving elsewhere. These include sequestration within the nucleus, protein stabilization to prevent transport elsewhere and the active retrieval of proteins that escape the nucleus. ; ubiquitin ligase complex : A protein complex that includes a ubiquitin-protein ligase and enables ubiquitin protein ligase activity. The complex also contains other proteins that may confer substrate specificity on the complex. ; photoreceptor connecting cilium : The portion of the photoreceptor cell cilium linking the photoreceptor inner and outer segments. It's considered to be equivalent to the ciliary transition zone. ; DNA topoisomerase binding : Interacting selectively and non-covalently with a DNA topoisomerase. ; midbody : A thin cytoplasmic bridge formed between daughter cells at the end of cytokinesis. The midbody forms where the contractile ring constricts, and may persist for some time before finally breaking to complete cytokinesis. ; protein K48-linked ubiquitination : A protein ubiquitination process in which a polymer of ubiquitin, formed by linkages between lysine residues at position 48 of the ubiquitin monomers, is added to a protein. K48-linked ubiquitination targets the substrate protein for degradation. ; retinal rod cell development : Development of a rod cell, one of the sensory cells in the eye that reacts to the presence of light. Rod cells contain the photopigment rhodopsin or porphyropsin and are responsible for vision in dim light. ; retina layer formation : The process in which the vertebrate retina is organized into three laminae: the outer nuclear layer (ONL), which contains photoreceptor nuclei; the inner nuclear layer (INL), which contains amacrine, bipolar and horizontal cells; and the retinal ganglion cell (RGC) layer. Between the inner and outer nuclear layers, the outer plexiform layer (OPL) contains connections between the photoreceptors and bipolar and horizontal cells. The inner plexiform layer (IPL) is positioned between the INL and the ganglion cell layer and contains the dendrites of RGCs and processes of bipolar and amacrine cells. Spanning all layers of the retina are the radially oriented Mueller glia. ; photoreceptor cell outer segment organization : A process that is carried out at the cellular level and results in the assembly, arrangement of constituent parts, or disassembly of the outer segment of a photoreceptor cell, a sensory cell that reacts to the presence of light. The outer segment of the photoreceptor cell contains the light-absorbing materials. ; regulation of cell population proliferation : Any process that modulates the frequency, rate or extent of cell proliferation. ; intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator : A series of molecular signals in which an intracellular signal is conveyed to trigger the apoptotic death of a cell. The pathway is induced by the cell cycle regulator phosphoprotein p53, or an equivalent protein, in response to the detection of DNA damage, and ends when the execution phase of apoptosis is triggered. ; positive regulation of transcription, DNA-templated : Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription. ; retinal cone cell development : Development of a cone cell, one of the sensory cells in the eye that reacts to the presence of light. Cone cells contain the photopigment iodopsin or cyanopsin and are responsible for photopic (daylight) vision. ; gamma-tubulin complex : A multiprotein complex composed of gamma-tubulin and other non-tubulin proteins. Gamma-tubulin complexes are localized to microtubule organizing centers, and play an important role in the nucleation of microtubules. The number and complexity of non-tubulin proteins associated with these complexes varies between species. ;


Symbol
TOPORS
Name
TOP1 binding arginine/serine rich protein, E3 ubiquitin ligase
Entrez ID
10210
Ensembl ID
ENSG00000197579    (more details)
KEGG ID
hsa:10210    (more details)
OMIM ID
609507
Uniprot ID
Q9NS56  
GO ID
hsa:10210    (more details)
Chromosome
7
Strand
-1
Start
33094797
End
33109405
miRNA Interactions
hsa-miR-29b-3p (RPM: 118.8178) / hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-29a-3p (RPM: 1246.9046) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-340-5p (RPM: 285.763) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-339-5p (RPM: 44.716) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-32-3p (RPM: 2.4438) / hsa-miR-519d-3p (RPM: 0.0042) / hsa-miR-221-3p (RPM: 758.7978) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-127-5p (RPM: 9.9124) / hsa-miR-19b-1-5p (RPM: 0.1482) / hsa-miR-21-5p (RPM: 5494.851) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-4511 (RPM: 0.216) / hsa-miR-5690 (RPM: 1.0164) / hsa-miR-502-5p (RPM: 0.9904) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-193b-3p (RPM: 184.968) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-1246 (RPM: 1.4034) / hsa-miR-29b-2-5p (RPM: 5.083) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-20b-5p (RPM: 24.4036) / hsa-miR-550a-3p (RPM: 2.5866) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-10a-5p (RPM: 408.7974) / hsa-miR-210-3p (RPM: 361.0562) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGGGGTCGCAGCCGCCGCTGGGGTCTCCGCTGTCTCGCGAGGAGGGTGAAGCGCCCCCGCCTGCTCCCGCTTCGGAGGGTAGGCGGAGAAGTCGCCGGGTACGCCTTCGCGGATCCTGCCGACACCGACCTAGCTTTCTGGGCTGCCGGGAGCTCGCGGCGAGCGCCCCAGCCAGGCCTGCGCCGGCATCCTCCGAGATAATGGCATCAGCTGCTAAGGAATTTAAAATGGACAACTTTTCACCTAAAGCTGGCACTAGCAAATTGCAACAGACAGTACCAGCTGATGCATCTCCTGATTCTAAGTGTCCTATATGCTTGGATAGATTTGATAATGTGTCTTACTTAGATCGCTGCTTACATAAGTTCTGTTTTCGCTGTGTACAGGAGTGGTCAAAAAACAAAGCTGAATGCCCACTATGTAAACAGCCCTTTGATTCTATTTTCCATTCTGTGAGGGCAGAAGATGACTTCAAGGAGTATGTCCTAAGGCCTTCGTATAATGGTTCTTTTGTCACCCCTGATCGACGATTTCGCTACCGTACAACTCTGACAAGGGAACGAAATGCTTCTGTGTATTCACCTAGTGGTCCTGTGAACAGAAGAACAACAACTCCACCGGATAGTGGAGTACTGTTTGAAGGGTTAGGCATTTCAACAAGACCTAGAGATGTTGAAATTCCTCAGTTTATGAGACAGATTGCAGTAAGGAGGCCAACTACGGCAGATGAAAGATCTTTGCGGAAAATTCAAGAACAAGATATTATTAATTTTAGACGAACTCTTTATCGTGCTGGTGCTCGAGTTAGAAATATTGAAGATGGTGGCCGCTACAGGGATATTTCAGCTGAATTTTTCCGTAGAAATCCAGCTTGCCTTCACAGATTAGTCCCCTGGTTAAAACGTGAACTTACAGTTCTTTTTGGAGCTCATGGATCTTTAGTGAATATTGTCCAGCATATTATCATGAGTAATGTTACTCGCTATGACTTGGAGAGTCAGGCATTTGTGTCTGATTTAAGACCATTTTTACTTAATCGAACTGAGCATTTTATACATGAATTTATCAGTTTTGCCCGATCTCCTTTTAACATGGCAGCCTTTGACCAGCATGCCAATTATGATTGCCCTGCTCCTTCATACGAAGAAGGCAGCCATTCTGATTCTTCAGTCATAACAATATCTCCAGATGAGGCTGAGACCCAAGAGCTGGATATTAATGTAGCCACTGTTAGTCAGGCACCATGGGATGATGAAACTCCAGGACCATCTTACTCAAGCTCAGAGCAGGTACACGTTACTATGTCTTCTCTTTTAAATACTTCTGACAGTTCAGATGAAGAACTTGTCACAGGAGGAGCCACGTCTCAGATACAAGGAGTACAAACCAATGACGACCTAAATAATGACAGTGATGATTCTTCAGATAATTGTGTCATTGTTGGGTTTGTTAAACCACTAGCTGAGAGGACCCCAGAACTTGTTGAACTGTCCTCTGATTCTGAGGACTTAGGTTCTTATGAGAAAATGGAGACAGTGAAGACACAAGAACAGGAGCAATCTTACAGTTCTGGTGATAGCGATGTTAGTAGATGCTCATCTCCACACTCTGTCCTTGGAAAGGATGAACAAATAAATAAAGGTCATTGTGATTCTAGTACAAGAATCAAATCAAAGAAGGAAGAGAAACGATCTACATCATTGTCATCTCCCAGAAACCTGAACTCATCTGTAAGAGGAGACAGAGTATATTCTCCATATAACCATAGACACAGAAAGAGGGGAAGATCAAGAAGTTCAGATTCACGTTCTCAGAGTAGAAGTGGGCATGATCAGAAGAATCATAGAAAGCATCATGGGAAGAAAAGAATGAAAAGTAAACGATCCAGAAGCAGGGAAAGTAGCAGACCTAGAGGGAGAAGAGACAAAAAGAGATCAAGAACTAGAGATAGCAGTTGGTCCAGAAGAAGCCAAACTCTGTCTCTAAGTAGTGAAAGCACAAGCAGATCAAGGTCTCGTAGCAGTGATCATGGTAAAAGAAGATCACGGAGCAGAAATAGAGATCGTTATTATTTAAGAAATAATTATGGAAGCAGATACAAATGGGAGTATACTTATTACAGTAGAAACAAGGACAGGGATGGGTACGAATCATCTTACAGGAGGAGGACTCTGTCCAGAGCTCATTATTCTAGACAGTCTTCAAGTCCAGAATTTAGAGTTCAGTCCTTTTCTGAAAGAACAAATGCTAGGAAAAAAAATAATCACAGTGAGAGGAAGTATTACTACTATGAAAGGCACAGATCAAGGAGCCTGTCTAGTAACAGATCAAGGACTGCATCTACCGGGACTGACCGGGTGAGAAATGAAAAGCCTGGAGGGAAACGAAAATACAAAACACGGCATTTGGAGGGTACTAACGAAGTGGCTCAGCCATCTCGTGAATTTGCTTCTAAAGCAAAGGACAGTCATTACCAAAAATCTTCATCAAAATTGGATGGAAACTACAAAAATGAGAGTGATACCTTTTCAGACAGCCGATCATCAGACAGAGAGACAAAACACAAAAGGAGAAAAAGGAAGACCCGGAGCCTAAGTGTAGAGATAGTTTATGAAGGAAAAGCTACTGATACAACTAAACACCATAAAAAGAAAAAGAAGAAACATAAGAAGAAGCATAAGAAACACCATGGAGATAATGCTTCACGTTCCCCAGTTGTAATTACCATTGACAGTGACAGTGATAAGGATTCTGAAGTAAAGGAGGATACAGAATGTGACAATAGTGGTCCTCAAGACCCTCTACAAAATGAGTTTTTGGCTCCTTCCTTGGAACCATTTGAAACTAAAGATGTAGTTACAATAGAAGCTGAATTTGGTGTGCTGGACAAGGAATGTGATATTGCCACACTTAGTAACAACTTGAATAATGCCAACAAAACTGTAGATAATATTCCACCTCTGGCAGCTTCAGTTGAACAAACTCTCGATGTAAGAGAAGAGAGCACCTTTGTTTCTGATTTGGAGAACCAGCCCAGTAACATTGTGTCTCTTCAAACTGAGCCATCAAGGCAATTGCCATCGCCACGGACATCATTAATGTCAGTATGTCTTGGTAGAGACTGTGATATGTCTTAA

Back to List