Details for gene: SCO2


Cytochrome c oxidase (COX) catalyzes the transfer of electrons from cytochrome c to molecular oxygen, which helps to maintain the proton gradient across the inner mitochondrial membrane that is necessary for aerobic ATP production. Human COX is a multimeric protein complex that requires several assembly factors; this gene encodes one of the COX assembly factors. The encoded protein is a metallochaperone that is involved in the biogenesis of cytochrome c oxidase subunit II. Mutations in this gene are associated with fatal infantile encephalocardiomyopathy and myopia 6. [provided by RefSeq, Oct 2014]


Symbol
SCO2
Name
synthesis of cytochrome C oxidase 2
Entrez ID
9997
Ensembl ID
ENSG00000284194    (more details)
KEGG ID
hsa:9997    (more details)
OMIM ID
608908
Uniprot ID
O43819  
GO ID
hsa:9997    (more details)
Chromosome
22
Strand
-1
Start
50523568
End
50526461
miRNA Interactions
hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-183-3p (RPM: 43.8344) / hsa-miR-182-3p (RPM: 20.9678) /
Involved Diseases
myopia /
Involved Pathways
Central carbon metabolism in cancer / Generic Transcription Pathway / RNA Polymerase II Transcription / Gene expression (Transcription) / Metabolism / Transcriptional Regulation by TP53 / The citric acid (TCA) cycle and respiratory electron transport / Respiratory electron transport, ATP synthesis by chemiosmotic coupling, and heat production by uncoupling proteins. / TP53 Regulates Metabolic Genes / Respiratory electron transport /
Sequence
GGCTCAGCGGACACGCGGGGACTCAGGCCCAGGGCGCTGCCCGGGTGGCCGCGGCGCTGGACGACGGCTCGGCCCTTGGCCGCTTCGAGCGGATGCTGGCGGCGCAGGGCGTGGATCCCGGTCTGGCCCGAGCCCTGTGCTCGGGAAGTCCCGCAGAACGCCGGCAGCTGCTGCCTCGCGCCCGGGAGCAGGAGGAGCTGCTGGCGCCCGCAGATGGTGAGCGTCGGGGGAGTCCCCGTCCTTCCGCCTCCGCCATCCCCTTCCCTTCCCGAGGCCCCGCCCCTTCCCGAGCCCGCGCCTCTCAGCCCCTCTCCCCGCAGGCACCGTGGAGCTGGTCCGGGCGCTGCCGCTGGCGCTGGTGCTGCACGAGCTCGGGGCCGGGCGCAGCCGCGCTGGGGAGCCGCTCCGCCTGGGGGTGGGCGCAGAGCTGCTGGTCGACGTGGGTCAGAGGCTGCGCCGTGGTGAGCGCCGCCCCCGCCCTGCTGGCCCCGCACCCCCGCCCAGCTCCGGCCGCGCGGCCTCTAACAGCCCCTCGCTCTGCAGGGACCCCCTGGCTCCGCGTGCACCGGGACGGCCCCGCGCTCAGCGGCCCGCAGAGCCGCGCCCTGCAGGAGGCGCTCGTACTCTCCGACCGCGCGCCATTCGCCGCCCCCTCGCCCTTCGCAGAGCTCGTTCTGCCGCCGCAGCAATAAAGCTCCTTTGCCGCGAAACCTTGTCAGTGCTTGGGCGGGAGCGGAAGGATCCAGGGCTGCGGAGGCGGGGGCCGTCTCGATGAACACGTGACCCCCGGCGGGCTCCGCCTTCCGCGCACGCGCTGAGAGCCTGTCAGCGGCTGCGCCCGTGTGCGCATGCGCAGCTCCGGGGACGCCTGCGCCCTGCCTGTGAGCGTGTGGCGCCCGCTTTCCCTGAGCCGGCGGGGCAGAGCGCAGGGAGCTGGAGGTCGGCGCTTCCTCTCGTGCTTGGTCCACTGACGCGCGGCCCCGCCGCGAGGTGCGGACGCCGGGGCTGGGAGGGGAGGAGGTAGCCCTGAGGACTCGCTGGACTCCGGGGTAGTTTCCCAGCTCCGGCTACTGCGCGGGGCTGGCGGGGCACACCCCAGGGCGCGCTGGAGGCCGGAGCGAGGCTGGGGCGCCCGTGGGAGGCTCCCAGCAGGCACCGGTGTTCTCGCGGCCAAGCACAGTTATAACGCGCTCGCGCGGCGCTTCGAGTGGTCCTGGAACCTTTCTGGCCACGAGGGCGCTGGCCTTGCTGGGGAGGGCACAAACCCAGAACCGCCCGGGCGGGGGTGCAGTGAGTCCTCGGGAGGGTGCCCTCAGCAGGAGGGGGCAGTGACCGGGAGTCCTGAGACCTCCACCTAGCAAACCTTCTGCGGGGGCCCGTGGGAAAGGCTCAAAGGTCACCAACGCAAAGGCAGGGCGTCGGCTGTGAGCCCGGAGGAGCTGCTGGGAAGCCTGGATGTGAGGAGGGTGGGGTTTTGTGGCGGGTGGAAGTGTCGTGCGTCTCTGCCAGGAGAGGTTAAACACAGCCGGCGGGCAGAGTCTGAGCTCCGGGGGTAGGTCGTGCAGGTTTTCTGCTGGGAGTGTGGAGGAAGGCCGCGGTTGGTTGAAGTGGCTGGAGGTAACAGGAAAGTGTTGGAGGAATCGGTTGCTCTCGGGGATTGCAAGCCAGAGAGTTACCCACCTCCTTTTAAGAAATGGGTTTATTGCAAATAGATAACGTGGTTAGTTCAGGCAAGGCATGCACTTGGAATGCTTTCCGTCAGCAAGAGGTTCACCTTGCTGAGGTGCAGGTGCAGGGCAGGGTGCGGTGACAGGCTGGTGATCCCAGGTAGAGGACAGGAGTGACAGGTGTGGTTGCCCAGGTGTGGATGTTTGGTGGAGGTGGAGTTCTGAGCTCAGGTGAGCAGCTGCAAATGCCTGTTAAGCCTGAACGTGGGCTGGGTCCTTCAGATGGGTGGCTGGTCTCAAGTCGCAGGGGCAGCCCAGGCACTGTCCTGGGCCTTCCCTTCTGGCTCCTGACGCCTGTGCTTGTTTCCAGGAGCATCAGATCCATGCTGCTGCTGACTCGGAGCCCCACAGCTTGGCACAGGCTCTCTCAGCTCAAGCCTCGGGTCCTCCCTGGGACCCTGGGAGGCCAGGCCCTGCATCTGAGGTCCTGGCTTTTGTCAAGGCAGGGCCCTGCAGAGACAGGTGGGCAGGGCCAGCCCCAGGGCCCTGGGCTTCGAACCCGGCTGCTGATCACAGGCCTGTTCGGGGCTGGACTCGGTGGGGCCTGGCTGGCCCTGAGGGCTGAGAAGGAGAGGCTGCAGCAGCAAAAGCGAACAGAAGCCCTGCGCCAGGCAGCTGTGGGCCAGGGCGACTTCCACCTGCTGGATCACAGAGGCCGGGCTCGCTGCAAGGCTGACTTCCGGGGCCAGTGGGTGCTGATGTACTTTGGCTTCACTCACTGCCCTGACATCTGCCCAGACGAGCTGGAGAAGCTGGTGCAGGTGGTGCGGCAGCTGGAAGCAGAGCCTGGTTTGCCTCCAGTGCAGCCTGTCTTCATCACTGTGGACCCCGAGCGGGACGACGTTGAAGCCATGGCCCGCTACGTCCAGGACTTCCACCCAAGACTGTTGGGTCTGACCGGCTCCACCAAACAGGTTGCCCAGGCTAGTCACAGTTACCGCGTGTACTACAATGCAGGCCCCAAGGATGAGGACCAGGACTACATCGTGGACCACTCCATTGCCATCTACCTGCTCAACCCTGACGGCCTCTTCACGGATTACTACGGCCGGAGCAGATCGGCTGAGCAGATCTCAGACAGTGTGCGGCGGCACATGGCGGCTTTCCGCAGTGTCCTGTCTTGAGCCACTGCAGTCTGGGCCCCATCATTAAACGGGCTGCGTTTAA

Back to List