Details for gene: MERTK


ATP binding : Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; protein phosphorylation : The process of introducing a phosphate group on to a protein. ; protein kinase activity : Catalysis of the phosphorylation of an amino acid residue in a protein, usually according to the reaction: a protein + ATP = a phosphoprotein + ADP. ; protein tyrosine kinase activity : Catalysis of the reaction: ATP + a protein tyrosine = ADP + protein tyrosine phosphate. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; nucleotide binding : Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose. ; kinase activity : Catalysis of the transfer of a phosphate group, usually from ATP, to a substrate molecule. ; transferase activity : Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2. ; phosphorylation : The process of introducing a phosphate group into a molecule, usually with the formation of a phosphoric ester, a phosphoric anhydride or a phosphoric amide. ; transmembrane receptor protein tyrosine kinase activity : Combining with a signal and transmitting the signal from one side of the membrane to the other to initiate a change in cell activity by catalysis of the reaction: ATP + a protein-L-tyrosine = ADP + a protein-L-tyrosine phosphate. ; peptidyl-tyrosine phosphorylation : The phosphorylation of peptidyl-tyrosine to form peptidyl-O4'-phospho-L-tyrosine. ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; integral component of plasma membrane : The component of the plasma membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; nervous system development : The process whose specific outcome is the progression of nervous tissue over time, from its formation to its mature state. ; cell migration : The controlled self-propelled movement of a cell from one site to a destination guided by molecular cues. Cell migration is a central process in the development and maintenance of multicellular organisms. ; cell-cell signaling : Any process that mediates the transfer of information from one cell to another. This process includes signal transduction in the receiving cell and, where applicable, release of a ligand and any processes that actively facilitate its transport and presentation to the receiving cell. Examples include signaling via soluble ligands, via cell adhesion molecules and via gap junctions. ; receptor complex : Any protein complex that undergoes combination with a hormone, neurotransmitter, drug or intracellular messenger to initiate a change in cell function. ; cell surface receptor signaling pathway : A series of molecular signals initiated by activation of a receptor on the surface of a cell. The pathway begins with binding of an extracellular ligand to a cell surface receptor, or for receptors that signal in the absence of a ligand, by ligand-withdrawal or the activity of a constitutively active receptor. The pathway ends with regulation of a downstream cellular process, e.g. transcription. ; positive regulation of phagocytosis : Any process that activates or increases the frequency, rate or extent of phagocytosis. ; transmembrane receptor protein tyrosine kinase signaling pathway : A series of molecular signals initiated by the binding of an extracellular ligand to a receptor on the surface of the target cell where the receptor possesses tyrosine kinase activity, and ending with regulation of a downstream cellular process, e.g. transcription. ; positive regulation of kinase activity : Any process that activates or increases the frequency, rate or extent of kinase activity, the catalysis of the transfer of a phosphate group, usually from ATP, to a substrate molecule. ; phagocytosis : A vesicle-mediated transport process that results in the engulfment of external particulate material by phagocytes and their delivery to the lysosome. The particles are initially contained within phagocytic vacuoles (phagosomes), which then fuse with primary lysosomes to effect digestion of the particles. ; natural killer cell differentiation : The process in which a relatively unspecialized cell acquires the specialized features of a natural killer cell. ; negative regulation of cytokine production : Any process that stops, prevents, or reduces the rate of production of a cytokine. ; spermatogenesis : The developmental process by which male germ line stem cells self renew or give rise to successive cell types resulting in the development of a spermatozoa. ; platelet activation : A series of progressive, overlapping events triggered by exposure of the platelets to subendothelial tissue. These events include shape change, adhesiveness, aggregation, and release reactions. When carried through to completion, these events lead to the formation of a stable hemostatic plug. ; secretion by cell : The controlled release of a substance by a cell. ; substrate adhesion-dependent cell spreading : The morphogenetic process that results in flattening of a cell as a consequence of its adhesion to a substrate. ; apoptotic cell clearance : The recognition and removal of an apoptotic cell by a neighboring cell or by a phagocyte. ; protein kinase B signaling : A series of reactions, mediated by the intracellular serine/threonine kinase protein kinase B (also called AKT), which occurs as a result of a single trigger reaction or compound. ; negative regulation of lymphocyte activation : Any process that stops, prevents, or reduces the frequency, rate or extent of lymphocyte activation. ; retina development in camera-type eye : The process whose specific outcome is the progression of the retina over time, from its formation to the mature structure. The retina is the innermost layer or coating at the back of the eyeball, which is sensitive to light and in which the optic nerve terminates. ; vagina development : The reproductive developmental process whose specific outcome is the progression of the vagina over time, from its formation to the mature structure. ; neutrophil clearance : The selective elimination of senescent neutrophils from the body by autoregulatory mechanisms. ; negative regulation of leukocyte apoptotic process : Any process that stops, prevents, or reduces the frequency, rate or extent of leukocyte apoptotic process. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; rhabdomere : The specialized microvilli-containing organelle on the apical surfaces of a photoreceptor cell containing the visual pigment rhodopsin and most of the proteins involved in phototransduction. ; cellular process : Any process that is carried out at the cellular level, but not necessarily restricted to a single cell. For example, cell communication occurs among more than one cell, but occurs at the cellular level. ; : ;


Symbol
MERTK
Name
MER proto-oncogene, tyrosine kinase
Entrez ID
10461
Ensembl ID
ENSG00000153208    (more details)
KEGG ID
hsa:10461    (more details)
OMIM ID
604705
Uniprot ID
Q12866  
GO ID
hsa:10461    (more details)
Chromosome
2
Strand
1
Start
233307816
End
233347055
miRNA Interactions
hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-135b-5p (RPM: 25.9152) / hsa-miR-135a-5p (RPM: 34.8504) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-181b-5p (RPM: 3069.8278) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-200b-5p (RPM: 9.0166) / hsa-miR-200a-5p (RPM: 14.0094) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-126-3p (RPM: 494.5936) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-937-3p (RPM: 2.0792) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Cell surface interactions at the vascular wall /
Sequence
ATGGGGCCGGCCCCGCTGCCGCTGCTGCTGGGCCTCTTCCTCCCCGCGCTCTGGCGTAGAGCTATCACTGAGGCAAGGGAAGAAGCCAAGCCTTACCCGCTATTCCCGGGACCTTTTCCAGGGAGCCTGCAAACTGACCACACACCGCTGTTATCCCTTCCTCACGCCAGTGGGTACCAGCCTGCCTTGATGTTTTCACCAACCCAGCCTGGAAGACCACATACAGGAAACGTAGCCATTCCCCAGGTGACCTCTGTCGAATCAAAGCCCCTACCGCCTCTTGCCTTCAAACACACAGTTGGACACATAATACTTTCTGAACATAAAGGTGTCAAATTTAATTGCTCAATCAGTGTACCTAATATATACCAGGACACCACAATTTCTTGGTGGAAAGATGGGAAGGAATTGCTTGGGGCACATCATGCAATTACACAGTTTTATCCAGATGATGAAGTTACAGCAATAATCGCTTCCTTCAGCATAACCAGTGTGCAGCGTTCAGACAATGGGTCGTATATCTGTAAGATGAAAATAAACAATGAAGAGATCGTGTCTGATCCCATCTACATCGAAGTACAAGGACTTCCTCACTTTACTAAGCAGCCTGAGAGCATGAATGTCACCAGAAACACAGCCTTCAACCTCACCTGTCAGGCTGTGGGCCCGCCTGAGCCCGTCAACATTTTCTGGGTTCAAAACAGTAGCCGTGTTAACGAACAGCCTGAAAAATCCCCCTCCGTGCTAACTGTTCCAGGCCTGACGGAGATGGCGGTCTTCAGTTGTGAGGCCCACAATGACAAAGGGCTGACCGTGTCCAAGGGAGTGCAGATCAACATCAAAGCAATTCCCTCCCCACCAACTGAAGTCAGCATCCGTAACAGCACTGCACACAGCATTCTGATCTCCTGGGTTCCTGGTTTTGATGGATACTCCCCGTTCAGGAATTGCAGCATTCAGGTCAAGGAAGCTGATCCGCTGAGTAATGGCTCAGTCATGATTTTTAACACCTCTGCCTTACCACATCTGTACCAAATCAAGCAGCTGCAAGCCCTGGCTAATTACAGCATTGGTGTTTCCTGCATGAATGAAATAGGCTGGTCTGCAGTGAGCCCTTGGATTCTAGCCAGCACGACTGAAGGAGCCCCATCAGTAGCACCTTTAAATGTCACTGTGTTTCTGAATGAATCTAGTGATAATGTGGACATCAGATGGATGAAGCCTCCGACTAAGCAGCAGGATGGAGAACTGGTGGGCTACCGGATATCCCACGTGTGGCAGAGTGCAGGGATTTCCAAAGAGCTCTTGGAGGAAGTTGGCCAGAATGGCAGCCGAGCTCGGATCTCTGTTCAAGTCCACAATGCTACGTGCACAGTGAGGATTGCAGCCGTCACCAGAGGGGGAGTTGGGCCCTTCAGTGATCCAGTGAAAATATTTATCCCTGCACACGGTTGGGTAGATTATGCCCCCTCTTCAACTCCGGCGCCTGGCAACGCAGATCCTGTGCTCATCATCTTTGGCTGCTTTTGTGGATTTATTTTGATTGGGTTGATTTTATACATCTCCTTGGCCATCAGAAAAAGAGTCCAGGAGACAAAGTTTGGGAATGCATTCACAGAGGAGGATTCTGAATTAGTGGTGAATTATATAGCAAAGAAATCCTTCTGTCGGCGAGCCATTGAACTTACCTTACATAGCTTGGGAGTCAGTGAGGAACTACAAAATAAACTAGAAGATGTTGTGATTGACAGGAATCTTCTAATTCTTGGAAAAATTCTGGGTGAAGGAGAGTTTGGGTCTGTAATGGAAGGAAATCTTAAGCAGGAAGATGGGACCTCTCTGAAAGTGGCAGTGAAGACCATGAAGTTGGACAACTCTTCACAGCGGGAGATCGAGGAGTTTCTCAGTGAGGCAGCGTGCATGAAAGACTTCAGCCACCCAAATGTCATTCGACTTCTAGGTGTGTGTATAGAAATGAGCTCTCAAGGCATCCCAAAGCCCATGGTAATTTTACCCTTCATGAAATACGGGGACCTGCATACTTACTTACTTTATTCCCGATTGGAGACAGGACCAAAGCATATTCCTCTGCAGACACTATTGAAGTTCATGGTGGATATTGCCCTGGGAATGGAGTATCTGAGCAACAGGAATTTTCTTCATCGAGATTTAGCTGCTCGAAACTGCATGTTGCGAGATGACATGACTGTCTGTGTTGCGGACTTCGGCCTCTCTAAGAAGATTTACAGTGGCGATTATTACCGCCAAGGCCGCATTGCTAAGATGCCTGTTAAATGGATCGCCATAGAAAGTCTTGCAGACCGAGTCTACACAAGTAAAAGTGATGTGTGGGCATTTGGCGTGACCATGTGGGAAATAGCTACGCGGGGAATGACTCCCTATCCTGGGGTCCAGAACCATGAGATGTATGACTATCTTCTCCATGGCCACAGGTTGAAGCAGCCCGAAGACTGCCTGGATGAACTGTATGAAATAATGTACTCTTGCTGGAGAACCGATCCCTTAGACCGCCCCACCTTTTCAGTATTGAGGCTGCAGCTAGAAAAACTCTTAGAAAGTTTGCCTGACGTTCGGAACCAAGCAGACGTTATTTACGTCAATACACAGTTGCTGGAGAGCTCTGAGGGCCTGGCCCAGGGCTCCACCCTTGCTCCACTGGACTTGAACATCGACCCTGACTCTATAATTGCCTCCTGCACTCCCCGCGCTGCCATCAGTGTGGTCACAGCAGAAGTTCATGACAGCAAACCTCATGAAGGACGGTACATCCTGAATGGGGGCAGTGAGGAATGGGAAGATCTGACTTCTGCCCCCTCTGCTGCAGTCACAGCTGAAAAGAACAGTGTTTTACCGGGGGAGAGACTTGTTAGGAATGGGGTCTCCTGGTCCCATTCGAGCATGCTGCCCTTGGGAAGCTCATTGCCCGATGAACTTTTGTTTGCTGACGACTCCTCAGAAGGCTCAGAAGTCCTGATGTGA

Back to List