Details for gene: PDAP1


RNA binding : Interacting selectively and non-covalently with an RNA molecule or a portion thereof. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; signal transduction : The cellular process in which a signal is conveyed to trigger a change in the activity or state of a cell. Signal transduction begins with reception of a signal (e.g. a ligand binding to a receptor or receptor activation by a stimulus such as light), or for signal transduction in the absence of ligand, signal-withdrawal or the activity of a constitutively active receptor. Signal transduction ends with regulation of a downstream cellular process, e.g. regulation of transcription or regulation of a metabolic process. Signal transduction covers signaling from receptors located on the surface of the cell and signaling via molecules located within the cell. For signaling between cells, signal transduction is restricted to events at and within the receiving cell. ; ficolin-1-rich granule lumen : Any membrane-enclosed lumen that is part of a ficolin-1-rich granule. ;


Symbol
PDAP1
Name
PDGFA associated protein 1
Entrez ID
11333
Ensembl ID
ENSG00000106244    (more details)
KEGG ID
hsa:11333    (more details)
OMIM ID
607075
Uniprot ID
Q13442  
GO ID
hsa:11333    (more details)
Chromosome
9
Strand
-1
Start
32540544
End
32552586
miRNA Interactions
hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-423-5p (RPM: 976.289) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-503-5p (RPM: 0.0972) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-877-3p (RPM: 0.509) / hsa-miR-328-3p (RPM: 137.931) / hsa-miR-494-3p (RPM: 1.1806) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-30c-2-3p (RPM: 52.8714) / hsa-miR-556-5p (RPM: 0.386) / hsa-miR-629-3p (RPM: 0.715) / hsa-miR-20a-3p (RPM: 0.8156) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-126-3p (RPM: 494.5936) / hsa-miR-191-5p (RPM: 12993.8088) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGCCTAAAGGAGGAAGAAAGGGAGGCCACAAAGGCCGGGCGAGGCAGTATACAAGCCCTGAGGAGATCGACGCGCAGCTGCAGGCTGAGAAGCAGAAGGCCAGGGAAGAAGAGGAGCAAAAAGAAGGTGGAGATGGGGCTGCAGGTGACCCCAAAAAGGAGAAGAAATCTCTAGACTCAGATGAGAGTGAGGATGAAGAAGATGACTACCAGCAAAAGCGCAAAGGCGTTGAAGGGCTCATCGACATCGAGAACCCCAACCGGGTGGCACAGACAACCAAAAAGGTCACACAACTGGATCTGGACGGGCCAAAGGAGCTTTCGAGGAGAGAACGAGAAGAGATTGAGAAGCAGAAGGCAAAAGAGCGTTACATGAAAATGCACTTGGCCGGGAAGACAGAGCAAGCCAAGGCTGACCTGGCCCGGCTGGCCATCATCCGGAAACAGCGGGAGGAGGCTGCCCGGAAGAAGGAAGAGGAAAGGAAAGCAAAAGACGATGCCACATTGTCAGGAAAACGAATGCAGTCACTCTCCCTGAATAAGTAA

Back to List