Details for gene: ATF6


regulation of transcription, DNA-templated : Any process that modulates the frequency, rate or extent of cellular DNA-templated transcription. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; DNA-binding transcription factor activity : A transcription regulator activity that modulates transcription of gene sets via selective and non-covalent binding to a specific double-stranded genomic DNA sequence (sometimes referred to as a motif) within a cis-regulatory region. Regulatory regions include promoters (proximal and distal) and enhancers. Genes are transcriptional units, and include bacterial operons. ; endoplasmic reticulum membrane : The lipid bilayer surrounding the endoplasmic reticulum. ; positive regulation of transcription by RNA polymerase II : Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter. ; cAMP response element binding : Interacting selectively and non-covalently with the cyclic AMP response element (CRE), a short palindrome-containing sequence found in the promoters of genes whose expression is regulated in response to cyclic AMP. ; endoplasmic reticulum unfolded protein response : The series of molecular signals generated as a consequence of the presence of unfolded proteins in the endoplasmic reticulum (ER) or other ER-related stress; results in changes in the regulation of transcription and translation. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; Golgi apparatus : A membrane-bound cytoplasmic organelle of the endomembrane system that further processes the core oligosaccharides (e.g. N-glycans) added to proteins in the endoplasmic reticulum and packages them into membrane-bound vesicles. The Golgi apparatus operates at the intersection of the secretory, lysosomal, and endocytic pathways. ; DNA binding : Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid). ; Golgi membrane : The lipid bilayer surrounding any of the compartments of the Golgi apparatus. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; response to unfolded protein : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an unfolded protein stimulus. ; RNA polymerase II transcription regulatory region sequence-specific DNA binding : Interacting selectively and non-covalently with a specific sequence of DNA that is part of a regulatory region that controls the transcription of a gene or cistron by RNA polymerase II. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; regulation of transcription by RNA polymerase II : Any process that modulates the frequency, rate or extent of transcription mediated by RNA polymerase II. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; DNA-binding transcription factor activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that modulates the transcription of specific gene sets transcribed by RNA polymerase II. ; RNA polymerase II cis-regulatory region sequence-specific DNA binding : Interacting selectively and non-covalently with a specific upstream regulatory DNA sequence (transcription factor recognition sequence or binding site) located in cis relative to the transcription start site (i.e., on the same strand of DNA) of a gene transcribed by RNA polymerase II. ; chromatin : The ordered and organized complex of DNA, protein, and sometimes RNA, that forms the chromosome. ; sequence-specific double-stranded DNA binding : Interacting selectively and non-covalently with double-stranded DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA, e.g. promotor binding or rDNA binding. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; eye development : The process whose specific outcome is the progression of the eye over time, from its formation to the mature structure. The eye is the organ of sight. ; DNA-binding transcription activator activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that activates or increases transcription of specific gene sets transcribed by RNA polymerase II. ; sequence-specific DNA binding : Interacting selectively and non-covalently with DNA of a specific nucleotide composition, e.g. GC-rich DNA binding, or with a specific sequence motif or type of DNA e.g. promotor binding or rDNA binding. ; nuclear envelope : The double lipid bilayer enclosing the nucleus and separating its contents from the rest of the cytoplasm; includes the intermembrane space, a gap of width 20-40 nm (also called the perinuclear space). ; signal transduction : The cellular process in which a signal is conveyed to trigger a change in the activity or state of a cell. Signal transduction begins with reception of a signal (e.g. a ligand binding to a receptor or receptor activation by a stimulus such as light), or for signal transduction in the absence of ligand, signal-withdrawal or the activity of a constitutively active receptor. Signal transduction ends with regulation of a downstream cellular process, e.g. regulation of transcription or regulation of a metabolic process. Signal transduction covers signaling from receptors located on the surface of the cell and signaling via molecules located within the cell. For signaling between cells, signal transduction is restricted to events at and within the receiving cell. ; protein heterodimerization activity : Interacting selectively and non-covalently with a nonidentical protein to form a heterodimer. ; positive regulation of apoptotic process : Any process that activates or increases the frequency, rate or extent of cell death by apoptotic process. ; protein folding : The process of assisting in the covalent and noncovalent assembly of single chain polypeptides or multisubunit complexes into the correct tertiary structure. ; ATF6-mediated unfolded protein response : A series of molecular signals mediated by the endoplasmic reticulum membrane stress sensor ATF6 (activating transcription factor 6). Begins with activation of ATF6 in response to endoplasmic reticulum (ER) stress, and ends with regulation of a downstream cellular process, e.g. transcription. Under conditions of endoplasmic reticulum stress, ATF6 translocates to the Golgi where it is processed by proteases to release a cytoplasmic domain (ATF6f), which operates as a transcriptional activator of many genes required to restore folding capacity. ; positive regulation of transcription from RNA polymerase II promoter in response to endoplasmic reticulum stress : Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter as a result of an endoplasmic reticulum stress. ; transcription cis-regulatory region binding : Interacting selectively and non-covalently with a specific sequence of DNA that is part of a regulatory region that controls transcription of that section of the DNA. The transcribed region might be described as a gene, cistron, or operon. ; positive regulation of autophagy : Any process that activates, maintains or increases the rate of autophagy. Autophagy is the process in which cells digest parts of their own cytoplasm. ; ubiquitin protein ligase binding : Interacting selectively and non-covalently with a ubiquitin protein ligase enzyme, any of the E3 proteins. ; positive regulation of ATF6-mediated unfolded protein response : Any process that activates or increases the frequency, rate or extent of the ATF6-mediated unfolded protein response. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; integral component of endoplasmic reticulum membrane : The component of the endoplasmic reticulum membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ;


Symbol
ATF6
Name
activating transcription factor 6
Entrez ID
22926
Ensembl ID
ENSG00000118217    (more details)
KEGG ID
hsa:22926    (more details)
OMIM ID
605537
Uniprot ID
A8K383  
GO ID
hsa:22926    (more details)
Chromosome
8
Strand
1
Start
63048553
End
63086053
miRNA Interactions
hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-126-5p (RPM: 3089.0568) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-338-3p (RPM: 158.4942) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-503-5p (RPM: 0.0972) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-7-5p (RPM: 19.3682) / hsa-miR-199a-5p (RPM: 174.3046) / hsa-miR-4728-5p (RPM: 0.1204) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-185-5p (RPM: 29.191) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-940 (RPM: 4.614) / hsa-miR-346 (RPM: 2.6286) / hsa-miR-30b-3p (RPM: 13.9872) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-323a-5p (RPM: 0.534) / hsa-miR-149-3p (RPM: 0.3876) / hsa-miR-22-5p (RPM: 21.6092) / hsa-miR-708-3p (RPM: 46.9334) / hsa-miR-873-3p (RPM: 8.911) / hsa-miR-31-5p (RPM: 310.1326) / hsa-miR-29b-2-5p (RPM: 5.083) / hsa-miR-146b-5p (RPM: 934.8654) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-335-5p (RPM: 265.7294) / hsa-miR-4661-5p (RPM: 0.7534) / hsa-miR-139-3p (RPM: 0.998) / hsa-miR-181c-3p (RPM: 135.7028) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-1306-3p (RPM: 0.8504) / hsa-miR-6785-5p (RPM: 0.0412) / hsa-miR-6883-5p (RPM: 0.0016) / hsa-miR-7106-5p (RPM: 0.007) / hsa-miR-1273h-5p (RPM: 0.1102) / hsa-miR-6780a-5p (RPM: 0.2598) / hsa-miR-6779-5p (RPM: 0.1952) / hsa-miR-552-5p (RPM: 0.0208) / hsa-miR-6799-5p (RPM: 0.0034) / hsa-miR-6871-5p (RPM: 0.0952) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Protein processing in endoplasmic reticulum / Alzheimer's disease /
Sequence
ATGGGGGAGCCGGCTGGGGTTGCCGGCACCATGGAGTCACCTTTTAGCCCGGGACTCTTTCACAGGCTGGATGAAGATTGGGATTCTGCTCTCTTTGCTGAACTCGGTTATTTCACAGACACTGATGAGCTGCAATTGGAAGCAGCAAATGAGACGTATGAAAACAATTTTGATAATCTTGATTTTGATTTGGATTTGATGCCTTGGGAGTCAGACATTTGGGACATCAACAACCAAATCTGTACAGTTAAAGATATTAAGGCAGAACCTCAGCCACTTTCTCCAGCCTCCTCAAGTTATTCAGTCTCGTCTCCTCGGTCAGTGGACTCTTATTCTTCAACTCAGCATGTTCCTGAGGAGTTGGATTTGTCTTCTAGTTCTCAGATGTCTCCCCTTTCCTTATATGGTGAAAACTCTAATAGTCTCTCTTCAGCGGAGCCACTGAAGGAAGATAAGCCTGTCACTGGTCCTAGGAACAAGACTGAAAATGGACTGACTCCAAAGAAAAAAATTCAGGTGAATTCAAAACCTTCAATTCAGCCCAAGCCTTTATTGCTTCCAGCAGCACCCAAGACTCAAACAAACTCCAGTGTTCCAGCAAAAACCATCATTATTCAGACAGTACCAACGCTTATGCCATTGGCAAAGCAGCAACCAATTATCAGTTTACAACCTGCACCCACTAAAGGCCAGACGGTTTTGCTGTCTCAGCCTACTGTGGTACAACTTCAAGCACCTGGAGTTCTGCCCTCTGCTCAGCCAGTCCTTGCTGTTGCTGGGGGAGTCACACAGCTCCCTAATCACGTGGTGAATGTGGTACCAGCCCCTTCAGCGAATAGCCCAGTGAATGGAAAACTTTCCGTGACTAAACCTGTCCTACAAAGTACCATGAGAAATGTCGGTTCAGATATTGCTGTGCTAAGGAGACAGCAACGTATGATAAAAAATCGAGAATCCGCTTGTCAGTCTCGCAAGAAGAAGAAAGAATATATGCTAGGGTTAGAGGCGAGATTAAAGGCTGCCCTCTCAGAAAACGAGCAACTGAAGAAAGAAAATGGAACACTGAAGCGGCAGCTGGATGAAGTTGTGTCAGAGAACCAGAGGCTTAAAGTCCCTAGTCCAAAGCGAAGAGTTGTCTGTGTGATGATAGTATTGGCATTTATAATACTGAACTATGGACCTATGAGCATGTTGGAACAGGATTCCAGGAGAATGAACCCTAGTGTGAGCCCTGCAAATCAAAGGAGGCACCTTCTAGGATTTTCTGCTAAAGAGGCACAGGACACATCAGATGGTATTATCCAGAAAAACAGCTACAGATATGATCATTCTGTTTCAAATGACAAAGCCCTGATGGTGCTAACTGAAGAACCATTGCTTTACATTCCTCCACCTCCTTGTCAGCCCCTAATTAACACAACAGAGTCTCTCAGGTTAAATCATGAACTTCGAGGATGGGTTCATAGACATGAAGTAGAAAGGACCAAGTCAAGAAGAATGACAAATAATCAACAGAAAACCCGTATTCTTCAGGGTGCTCTGGAACAGGGCTCAAATTCTCAGCTGATGGCTGTTCAATACACAGAAACCACTAGTAGTATCAGCAGGAACTCAGGGAGTGAGCTACAAGTGTATTATGCTTCACCCAGAAGTTATCAAGACTTTTTTGAAGCCATCCGCAGAAGGGGAGACACATTTTATGTTGTGTCATTTCGAAGGGATCACCTGCTGTTACCAGCTACCACCCATAACAAGACCACAAGACCAAAAATGTCAATTGTGTTACCAGCAATAAACATAAATGAGAATGTGATCAATGGGCAGGACTACGAAGTGATGATGCAGATTGACTGTCAGGTGATGGACACCAGGATCCTCCATATCAAAAGTTCGTCAGTTCCTCCTTACCTCCGAGATCAGCAGAGGAATCAAACCAACACCTTCTTTGGCTCCCCTCCCGCAGCCACAGAGGCAACCCACGTTGTCAGCACCATCCCTGAGTCATTACAATAG

Back to List