Details for gene: SNRNP200


ATP binding : Interacting selectively and non-covalently with ATP, adenosine 5'-triphosphate, a universally important coenzyme and enzyme regulator. ; nucleic acid binding : Interacting selectively and non-covalently with any nucleic acid. ; RNA binding : Interacting selectively and non-covalently with an RNA molecule or a portion thereof. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; spliceosomal complex : Any of a series of ribonucleoprotein complexes that contain snRNA(s) and small nuclear ribonucleoproteins (snRNPs), and are formed sequentially during the spliceosomal splicing of one or more substrate RNAs, and which also contain the RNA substrate(s) from the initial target RNAs of splicing, the splicing intermediate RNA(s), to the final RNA products. During cis-splicing, the initial target RNA is a single, contiguous RNA transcript, whether mRNA, snoRNA, etc., and the released products are a spliced RNA and an excised intron, generally as a lariat structure. During trans-splicing, there are two initial substrate RNAs, the spliced leader RNA and a pre-mRNA. ; mRNA processing : Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide. ; RNA splicing : The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; nucleotide binding : Interacting selectively and non-covalently with a nucleotide, any compound consisting of a nucleoside that is esterified with (ortho)phosphate or an oligophosphate at any hydroxyl group on the ribose or deoxyribose. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; hydrolase activity : Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; RNA helicase activity : Catalysis of the reaction: ATP + H2O = ADP + phosphate; this reaction drives the unwinding of an RNA helix. ; helicase activity : Catalysis of the reaction: ATP + H2O = ADP + phosphate, to drive the unwinding of a DNA or RNA helix. ; ATPase : A molecular function characterized by the use of ATP hydrolysis as an energy source, for example to catalyze a reaction or drive transport against a concentration gradient. ; mRNA splicing, via spliceosome : The joining together of exons from one or more primary transcripts of messenger RNA (mRNA) and the excision of intron sequences, via a spliceosomal mechanism, so that mRNA consisting only of the joined exons is produced. ; catalytic step 2 spliceosome : A spliceosomal complex that contains three snRNPs, including U5, bound to a splicing intermediate in which the first catalytic cleavage of the 5' splice site has occurred. The precise subunit composition differs significantly from that of the catalytic step 1, or activated, spliceosome, and includes many proteins in addition to those found in the associated snRNPs. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; U2-type catalytic step 1 spliceosome : A spliceosomal complex that is formed by the displacement of the U1 and U4 snRNPs from the precatalytic spliceosome; the U2, U5 and U6 snRNPs remain associated with the mRNA. This complex, sometimes called the activated spliceosome, is the catalytically active form of the spliceosome, and includes many proteins in addition to those found in the U2, and U5 and U6 snRNPs. ; U2-type precatalytic spliceosome : A spliceosomal complex that is formed by the recruitment of the preassembled U4/U6.U5 tri-snRNP to the prespliceosome. Although all 5 snRNPs are present, the precatalytic spliceosome is catalytically inactive. The precatalytic spliceosome includes many proteins in addition to those found in the U1, U2 and U4/U6.U5 snRNPs. ; U4/U6 x U5 tri-snRNP complex : A ribonucleoprotein complex that is formed by the association of the U4/U6 and U5 snRNPs. ; osteoblast differentiation : The process whereby a relatively unspecialized cell acquires the specialized features of an osteoblast, a mesodermal or neural crest cell that gives rise to bone. ; cis assembly of pre-catalytic spliceosome : Assembly of a spliceosomal complex containing the intact pre-mRNA and all of the spliceosomal snRNPs. This occurs when the tri-snRNP associates with the pre-mRNA and associated snRNPs in an ATP-dependent manner. ; spliceosome conformational change to release U4 (or U4atac) and U1 (or U11) : Rearrangement of the pre-catalytic spliceosome containing U4 (or U4atac) and U1 (or U11) snRNPs to unpair U4 (or U4atac) from U6 (or U6atac) and release it from the spliceosomal complex along with U1 (or U11). ; U5 snRNP : A ribonucleoprotein complex that contains small nuclear RNA U5, a heptameric ring of Sm proteins, as well as several proteins that are unique to the U5 snRNP, most of which remain associated with the U5 snRNA both while the U5 snRNP is free or assembled into a series of spliceosomal complexes. ; cellular component organization : A process that results in the assembly, arrangement of constituent parts, or disassembly of a cellular component. ; nucleic acid metabolic process : Any cellular metabolic process involving nucleic acids. ;


Symbol
SNRNP200
Name
small nuclear ribonucleoprotein U5 subunit 200
Entrez ID
23020
Ensembl ID
ENSG00000144028    (more details)
KEGG ID
hsa:23020    (more details)
OMIM ID
601664
Uniprot ID
O75643  
GO ID
hsa:23020    (more details)
Chromosome
11
Strand
-1
Start
8019244
End
8106243
miRNA Interactions
hsa-miR-15a-5p (RPM: 139.425) / hsa-miR-216a-5p (RPM: 20.4176) / hsa-miR-195-5p (RPM: 125.6474) / hsa-miR-15b-5p (RPM: 133.5752) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-922 (RPM: 0.0014) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-3662 (RPM: 0.0344) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-1301-3p (RPM: 47.2112) / hsa-miR-4786-3p (RPM: 0.0288) / hsa-miR-361-5p (RPM: 182.4758) / hsa-miR-766-5p (RPM: 0.1124) / hsa-miR-365a-3p (RPM: 22.318) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-miR-153-3p (RPM: 53.4548) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-miR-877-3p (RPM: 0.509) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-484 (RPM: 434.5276) / hsa-miR-149-5p (RPM: 312.3098) / hsa-miR-664a-3p (RPM: 65.4214) / hsa-miR-3657 (RPM: 0.0078) / hsa-miR-371a-5p (RPM: 0.0054) / hsa-miR-432-5p (RPM: 29.044) / hsa-miR-130a-5p (RPM: 1.1956) / hsa-miR-1304-3p (RPM: 12.7066) / hsa-miR-1296-5p (RPM: 36.5114) / hsa-miR-3150b-3p (RPM: 0.0582) / hsa-miR-3157-5p (RPM: 0.3264) / hsa-miR-3928-3p (RPM: 0.5162) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-616-5p (RPM: 3.0294) / hsa-miR-5690 (RPM: 1.0164) / hsa-miR-92a-1-5p (RPM: 8.113) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-193b-3p (RPM: 184.968) / hsa-miR-30c-2-3p (RPM: 52.8714) / hsa-miR-142-3p (RPM: 8.3404) / hsa-miR-30b-3p (RPM: 13.9872) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-485-3p (RPM: 10.0736) / hsa-miR-185-3p (RPM: 4.0636) / hsa-miR-20b-3p (RPM: 0.5872) / hsa-miR-23c (RPM: 1.4294) / hsa-miR-22-5p (RPM: 21.6092) / hsa-miR-221-5p (RPM: 32.1456) / hsa-miR-615-3p (RPM: 0.1424) / hsa-miR-769-5p (RPM: 505.4938) / hsa-miR-548b-3p (RPM: 0.1786) / hsa-miR-216b-5p (RPM: 11.7092) / hsa-miR-505-5p (RPM: 1.7508) / hsa-miR-545-3p (RPM: 0.0276) / hsa-miR-342-3p (RPM: 685.7862) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-532-5p (RPM: 129.2058) / hsa-miR-425-5p (RPM: 187.631) / hsa-miR-483-3p (RPM: 2.3898) / hsa-miR-502-3p (RPM: 26.4154) / hsa-miR-431-3p (RPM: 4.2164) / hsa-miR-151a-5p (RPM: 2651.1674) / hsa-miR-3613-5p (RPM: 2.9544) / hsa-miR-1224-3p (RPM: 0.0484) / hsa-miR-4685-3p (RPM: 0.7634) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-140-5p (RPM: 21.3322) / hsa-miR-370-3p (RPM: 8.8808) / hsa-miR-125a-3p (RPM: 24.5112) / hsa-miR-512-5p (RPM: 0.0024) / hsa-miR-143-5p (RPM: 18.0714) / hsa-miR-181c-3p (RPM: 135.7028) / hsa-miR-99a-5p (RPM: 1181.6944) / hsa-miR-92b-5p (RPM: 11.919) / hsa-miR-663a (RPM: 0.1414) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Spliceosome /
Sequence
ATGGCGGATGTAACCGCCCGTAGTCTGCAATACGAGTACAAGGCGAACTCGAATCTTGTGCTCCAAGCTGACCGTTCTCTCATTGACCGGACCCGCCGGGATGAACCCACAGGAGAGGTGCTGTCCCTTGTTGGGAAGCTGGAGGGCACCCGTATGGGAGACAAGGCTCAACGGACCAAACCGCAGATGCAGGAGGAAAGAAGAGCCAAGCGAAGAAAGCGTGATGAGGACCGGCATGACATCAACAAGATGAAGGGTTATACTCTGCTGTCGGAGGGCATTGATGAGATGGTGGGCATCATCTACAAGCCCAAAACTAAAGAGACTCGGGAGACCTATGAGGTGCTACTCAGCTTCATCCAGGCTGCTCTTGGGGACCAGCCACGTGATATCCTTTGTGGGGCAGCTGATGAAGTTCTAGCTGTTCTAAAGAATGAAAAGCTGCGGGACAAGGAAAGGCGAAAGGAGATTGACCTGCTGCTGGGTCAAACAGATGATACCAGATACCATGTGCTAGTGAACCTGGGCAAAAAGATCACAGACTATGGTGGAGATAAGGAAATCCAAAATATGGATGACAACATTGATGAGACATACGGTGTGAATGTGCAGTTTGAGTCTGATGAGGAGGAAGGTGATGAAGACGTATACGGGGAGGTTCGAGAAGAGGCATCTGATGATGACATGGAAGGGGACGAGGCTGTCGTGCGCTGCACCCTCTCGGCTAATCTCGTAGCCTCAGGTGAACTGATGAGTTCCAAGAAGAAGGATTTGCACCCTCGGGATATTGATGCATTTTGGCTGCAGCGGCAGCTCAGTCGTTTCTATGATGATGCCATCGTGTCGCAGAAGAAGGCAGATGAAGTATTGGAGATTTTGAAGACGGCCAGTGATGATCGGGAATGTGAAAATCAGCTGGTTCTGCTGCTTGGTTTCAACACCTTTGATTTCATTAAAGTGTTGCGGCAGCACAGGATGATGATTTTATACTGTACCTTGCTGGCCAGTGCACAAAGTGAAGCTGAAAAGGAAAGGATTATGGGAAAGATGGAAGCTGACCCAGAGCTATCCAAGTTCCTCTACCAGCTTCATGAAACCGAGAAGGAGGATCTGATCCGAGAGGAAAGGTCCCGGAGAGAGCGAGTGCGTCAGTCTCGAATGGACACAGATCTGGAAACCATGGATCTCGACCAGGGTGGAGAGGCACTGGCTCCACGGCAGGTTCTGGACTTGGAGGACCTGGTTTTTACCCAAGGGAGCCACTTTATGGCCAATAAACGCTGTCAGCTTCCTGATGGATCCTTCCGTCGCCAGCGTAAGGGCTATGAAGAGGTGCATGTGCCTGCTCTGAAGCCCAAGCCCTTTGGCTCAGAAGAACAACTGCTTCCAGTGGAAAAGCTGCCAAAGTATGCCCAGGCTGGGTTTGAGGGCTTCAAAACACTGAATCGGATCCAGAGTAAGCTCTACCGTGCTGCCCTTGAGACGGATGAGAATCTGCTGCTGTGTGCTCCTACTGGTGCTGGGAAGACCAACGTGGCCCTGATGTGCATGCTCCGAGAGATTGGGAAACACATAAACATGGACGGCACCATCAATGTGGATGACTTCAAGATTATCTACATTGCCCCCATGCGCTCCTTGGTGCAGGAGATGGTGGGCAGCTTTGGAAAGCGCCTGGCCACTTATGGCATCACTGTTGCTGAACTGACTGGGGACCACCAGCTGTGCAAAGAAGAGATCAGTGCCACTCAGATCATCGTCTGCACCCCCGAGAAGTGGGACATCATCACCCGCAAGGGTGGTGAGCGCACCTACACCCAGCTGGTGCGGCTCATCATTCTGGATGAGATTCATCTTCTCCACGATGACAGAGGTCCTGTCTTAGAAGCTTTAGTGGCCAGGGCCATCCGAAACATTGAGATGACCCAAGAGGATGTCCGACTCATTGGTCTCAGTGCCACCCTACCCAACTATGAAGATGTAGCCACCTTTCTACGTGTTGACCCTGCCAAGGGTCTCTTTTACTTTGACAACAGCTTCCGTCCAGTGCCTCTGGAACAGACATATGTGGGTATCACAGAGAAAAAAGCTATCAAGCGTTTCCAGATCATGAATGAAATCGTCTATGAAAAAATCATGGAACATGCTGGAAAAAATCAGGTGCTGGTGTTTGTCCACTCCCGGAAGGAGACTGGAAAGACAGCCAGGGCCATCCGGGACATGTGCCTAGAAAAGGACACTCTGGGTCTGTTTCTGAGGGAGGGCTCAGCCTCCACAGAAGTCCTGCGAACAGAAGCTGAGCAGTGCAAGAACCTAGAGCTGAAGGATCTTCTGCCTTATGGCTTTGCTATTCATCACGCAGGCATGACCAGGGTTGACCGAACACTCGTGGAGGATCTTTTTGCTGATAAACATATTCAGGTTTTAGTTTCCACAGCAACTCTAGCTTGGGGTGTGAATCTCCCTGCACATACAGTCATCATCAAAGGCACCCAGGTGTACAGTCCAGAGAAGGGGCGTTGGACAGAACTGGGAGCACTGGACATTCTGCAGATGCTGGGACGTGCCGGAAGACCCCAGTATGACACCAAGGGTGAAGGCATACTCATCACATCTCATGGGGAGCTACAGTACTACCTGTCCCTCCTCAATCAACAACTTCCTATTGAAAGCCAGATGGTTTCAAAGCTTCCTGACATGCTCAATGCAGAAATCGTGCTAGGAAATGTCCAGAATGCCAAGGATGCGGTGAACTGGCTGGGCTATGCCTACCTCTATATCCGAATGCTGCGATCCCCAACCCTCTATGGCATCTCTCATGATGACCTCAAGGGAGATCCCCTGCTGGACCAGCGCCGACTAGATCTGGTTCATACAGCTGCCCTGATGCTGGACAAGAACAATCTGGTCAAGTACGACAAGAAGACGGGCAACTTCCAGGTGACAGAACTGGGCCGTATAGCCAGCCACTACTACATCACCAATGATACAGTGCAGACTTACAACCAGCTGCTGAAGCCCACCCTGAGTGAGATTGAGCTTTTCAGGGTCTTCTCATTGTCCTCTGAGTTCAAGAACATCACAGTGAGAGAGGAGGAGAAGCTGGAGCTGCAGAAGTTGCTGGAGAGGGTGCCTATCCCTGTAAAGGAGAGCATTGAGGAACCCAGTGCTAAGATCAACGTTCTTCTGCAAGCCTTCATCTCACAGCTGAAATTGGAGGGCTTTGCACTGATGGCTGACATGGTGTATGTCACACAGTCGGCTGGCCGGTTGATGCGAGCGATATTTGAAATTGTCCTGAACCGAGGTTGGGCACAGCTTACAGACAAGACCCTGAACCTCTGCAAGATGATCGACAAACGCATGTGGCAGTCCATGTGTCCTCTGCGCCAGTTCCGGAAACTCCCTGAGGAAGTAGTGAAGAAGATTGAGAAGAAGAATTTCCCCTTTGAGCGTCTGTACGACCTGAATCATAATGAGATTGGGGAGCTTATCCGCATGCCAAAGATGGGGAAGACCATCCACAAATATGTCCATCTGTTTCCCAAGTTGGAGTTGTCAGTGCACCTGCAGCCTATCACACGCTCCACCCTGAAGGTGGAGCTGACCATCACGCCAGACTTCCAGTGGGATGAAAAGGTGCATGGTTCATCCGAGGCTTTTTGGATTCTGGTGGAGGATGTGGACAGCGAGGTGATTCTGCACCATGAGTATTTTCTCCTCAAGGCCAAGTACGCCCAGGACGAGCACCTCATTACATTCTTCGTGCCTGTCTTTGAACCGCTGCCCCCTCAGTACTTCATCCGAGTGGTGTCTGACCGCTGGCTCTCTTGTGAGACCCAGCTGCCTGTCTCCTTCCGGCACCTGATCTTGCCGGAGAAGTACCCCCCTCCAACCGAACTTTTGGACCTGCAGCCCTTGCCCGTGTCTGCTCTGAGAAACAGTGCCTTTGAGAGTCTTTACCAAGATAAATTTCCTTTCTTCAATCCCATCCAGACCCAGGTGTTTAACACTGTATACAACAGTGACGACAACGTGTTTGTGGGGGCCCCCACGGGCAGCGGGAAGACTATTTGTGCAGAGTTTGCCATCCTGCGAATGCTGCTGCAGAGCTCGGAGGGGCGCTGTGTGTACATCACCCCCATGGAGGCCCTGGCAGAGCAGGTATACATGGACTGGTACGAGAAGTTCCAGGACAGGCTCAACAAGAAGGTGGTACTCCTGACAGGCGAGACCAGCACAGACCTGAAGCTGCTGGGCAAAGGGAACATTATCATCAGCACCCCTGAGAAGTGGGACATACTTTCCCGGCGATGGAAGCAGCGCAAGAACGTGCAGAACATCAACCTCTTCGTGGTGGATGAGGTCCACCTTATCGGGGGCGAGAATGGGCCTGTCTTAGAAGTGATCTGCTCCCGAATGCGCTACATCTCCTCCCAGATTGAGCGGCCCATTCGCATTGTGGCACTCAGCTCTTCGCTCTCCAATGCCAAGGATGTGGCCCACTGGCTGGGCTGCAGTGCCACCTCCACCTTCAACTTCCATCCCAATGTGCGTCCCGTCCCCTTGGAGCTGCACATCCAGGGCTTCAACATCAGCCATACACAAACCCGCCTGCTCTCCATGGCCAAGCCTGTGTACCATGCTATCACCAAGCACTCGCCCAAGAAGCCTGTCATTGTCTTTGTGCCGTCTCGCAAGCAGACCCGCCTCACTGCCATTGACATCCTCACCACCTGTGCAGCAGACATCCAACGGCAGAGGTTCTTGCACTGCACCGAGAAGGATCTGATTCCGTACCTGGAGAAGCTAAGTGACAGCACGCTCAAGGAAACGCTGCTAAATGGGGTGGGCTACCTGCATGAGGGGCTCAGCCCCATGGAGCGACGCCTGGTGGAGCAGCTCTTCAGCTCAGGGGCTATCCAGGTGGTGGTGGCTTCTCGGAGTCTCTGCTGGGGCATGAACGTGGCTGCCCACCTGGTAATCATCATGGATACCCAGTACTACAATGGCAAGATCCACGCCTATGTGGATTACCCCATCTATGACGTGCTTCAGATGGTGGGCCACGCCAACCGCCCTTTGCAGGACGATGAGGGGCGCTGTGTCATCATGTGTCAGGGCTCCAAGAAGGATTTCTTCAAGAAGTTCTTATATGAGCCATTGCCAGTAGAATCTCACCTGGACCACTGTATGCATGACCACTTCAATGCTGAGATCGTCACCAAGACCATTGAGAACAAGCAGGATGCTGTGGACTACCTCACCTGGACCTTTCTGTACCGCCGCATGACACAGAACCCCAATTACTACAACCTGCAGGGCATCTCCCATCGTCACTTGTCGGACCACTTGTCAGAGCTGGTGGAGCAGACCCTGAGTGACCTGGAGCAGTCCAAGTGCATCAGCATCGAGGACGAGATGGACGTGGCGCCTCTGAACCTAGGCATGATCGCCGCCTACTATTACATCAACTACACCACCATTGAGCTCTTCAGCATGTCCCTCAATGCCAAGACCAAGGTGCGAGGGCTTATCGAGATCATCTCCAATGCAGCAGAGTATGAGAACATTCCCATCCGGCACCATGAAGACAATCTCCTGAGGCAGTTGGCTCAGAAGGTCCCCCACAAGCTGAATAACCCTAAGTTCAATGATCCGCACGTCAAGACCAACCTGCTCCTGCAGGCTCACTTGTCTCGCATGCAGCTGAGTGCTGAGTTGCAGTCAGATACGGAGGAAATCCTTAGTAAGGCAATCCGGCTCATCCAGGCCTGCGTGGATGTCCTTTCCAGCAATGGGTGGCTCAGCCCTGCTCTGGCAGCTATGGAACTGGCCCAGATGGTCACCCAAGCCATGTGGTCCAAGGACTCATACCTGAAGCAGCTGCCACACTTCACCTCTGAGCATATCAAACGTTGCACAGACAAGGGAGTGGAGAGTGTTTTCGACATCATGGAGATGGAGGATGAAGAACGGAACGCGTTGCTTCAGCTGACTGACAGCCAGATTGCAGATGTGGCTCGCTTTTGTAACCGCTACCCTAATATCGAACTATCTTATGAGGTGGTAGATAAGGACAGCATCCGCAGTGGCGGGCCAGTTGTGGTGCTGGTGCAGCTGGAGCGAGAGGAGGAAGTCACAGGCCCTGTCATTGCGCCTCTCTTCCCGCAGAAACGTGAAGAGGGCTGGTGGGTGGTGATTGGAGATGCCAAGTCCAATAGCCTCATCTCCATCAAGAGGCTGACCTTGCAGCAGAAGGCCAAGGTGAAGTTGGACTTTGTGGCCCCAGCCACTGGTGCCCACAACTACACTCTGTACTTCATGAGTGACGCTTACATGGGATGTGACCAGGAGTACAAATTCAGCGTGGATGTGAAAGAAGCTGAGACAGACAGTGATTCAGATTGA

Back to List