Details for gene: CRB1


calcium ion binding : Interacting selectively and non-covalently with calcium ions (Ca2+). ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; protein-containing complex : A stable assembly of two or more macromolecules, i.e. proteins, nucleic acids, carbohydrates or lipids, in which at least one component is a protein and the constituent parts function together. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; adherens junction : A cell-cell junction composed of the epithelial cadherin-catenin complex. The epithelial cadherins, or E-cadherins, of each interacting cell extend through the plasma membrane into the extracellular space and bind to each other. The E-cadherins bind to catenins on the cytoplasmic side of the membrane, where the E-cadherin-catenin complex binds to cytoskeletal components and regulatory and signaling molecules. ; apical plasma membrane : The region of the plasma membrane located at the apical end of the cell. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; photoreceptor inner segment : The inner segment of a vertebrate photoreceptor containing mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ; photoreceptor outer segment : The outer segment of a vertebrate photoreceptor that contains a stack of membrane discs embedded with photoreceptor proteins. ; cell-cell signaling : Any process that mediates the transfer of information from one cell to another. This process includes signal transduction in the receiving cell and, where applicable, release of a ligand and any processes that actively facilitate its transport and presentation to the receiving cell. Examples include signaling via soluble ligands, via cell adhesion molecules and via gap junctions. ; heterophilic cell-cell adhesion via plasma membrane cell adhesion molecules : The attachment of an adhesion molecule in one cell to a nonidentical adhesion molecule in an adjacent cell. ; establishment or maintenance of cell polarity : Any cellular process that results in the specification, formation or maintenance of anisotropic intracellular organization or cell growth patterns. ; establishment or maintenance of epithelial cell apical/basal polarity : Any cellular process that results in the specification, formation or maintenance of the apicobasal polarity of an epithelial cell. ; blood vessel remodeling : The reorganization or renovation of existing blood vessels. ; plasma membrane organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of the plasma membrane. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; glial cell differentiation : The process in which a relatively unspecialized cell acquires the specialized features of a glial cell. ; gene expression : The process in which a gene's sequence is converted into a mature gene product or products (proteins or RNA). This includes the production of an RNA transcript as well as any processing to produce a mature RNA product or an mRNA or circRNA (for protein-coding genes) and the translation of that mRNA or circRNA into protein. Protein maturation is included when required to form an active form of a product from an inactive precursor form. ; retina layer formation : The process in which the vertebrate retina is organized into three laminae: the outer nuclear layer (ONL), which contains photoreceptor nuclei; the inner nuclear layer (INL), which contains amacrine, bipolar and horizontal cells; and the retinal ganglion cell (RGC) layer. Between the inner and outer nuclear layers, the outer plexiform layer (OPL) contains connections between the photoreceptors and bipolar and horizontal cells. The inner plexiform layer (IPL) is positioned between the INL and the ganglion cell layer and contains the dendrites of RGCs and processes of bipolar and amacrine cells. Spanning all layers of the retina are the radially oriented Mueller glia. ; cellular protein localization : Any process in which a protein is transported to, and/or maintained in, a specific location at the level of a cell. Localization at the cellular level encompasses movement within the cell, from within the cell to the cell surface, or from one location to another at the surface of a cell. ; photoreceptor cell outer segment organization : A process that is carried out at the cellular level and results in the assembly, arrangement of constituent parts, or disassembly of the outer segment of a photoreceptor cell, a sensory cell that reacts to the presence of light. The outer segment of the photoreceptor cell contains the light-absorbing materials. ; eye photoreceptor cell development : Development of a photoreceptor, a sensory cell in the eye that reacts to the presence of light. They usually contain a pigment that undergoes a chemical change when light is absorbed, thus stimulating a nerve. ; photoreceptor cell maintenance : Any process preventing the degeneration of the photoreceptor, a specialized cell type that is sensitive to light. ; detection of light stimulus involved in visual perception : The series of events involved in visual perception in which a light stimulus is received and converted into a molecular signal. ; retina development in camera-type eye : The process whose specific outcome is the progression of the retina over time, from its formation to the mature structure. The retina is the innermost layer or coating at the back of the eyeball, which is sensitive to light and in which the optic nerve terminates. ; retina morphogenesis in camera-type eye : The process in which the anatomical structure of the retina is generated and organized. ; post-embryonic retina morphogenesis in camera-type eye : The process in which the anatomical structure of the retina is generated and organized in a camera-type eye during the post-embryonic life stage. ; membrane organization : A process which results in the assembly, arrangement of constituent parts, or disassembly of a membrane. A membrane is a double layer of lipid molecules that encloses all cells, and, in eukaryotes, many organelles; may be a single or double lipid bilayer; also includes associated proteins. ; establishment of bipolar cell polarity involved in cell morphogenesis : The specification and formation of bipolar intracellular organization or cell growth patterns that contribute to cell morphogenesis. Bipolar organization is the organization that is a mirror image along an axis from a plane. ; cellular response to light stimulus : Any process that results in a change in state or activity of a cell (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a light stimulus, electromagnetic radiation of wavelengths classified as infrared, visible or ultraviolet light. ; microvillus : Thin cylindrical membrane-covered projections on the surface of an animal cell containing a core bundle of actin filaments. Present in especially large numbers on the absorptive surface of intestinal cells. ; cell-cell junction : A cell junction that forms a connection between two or more cells in a multicellular organism; excludes direct cytoplasmic intercellular bridges, such as ring canals in insects. ; subapical complex : The most apical region of the lateral plasma membrane of an invertebrate epithelial cell. The subapical complex lies above the zonula adherens and the septate junction, and is comparable to the position of the tight junction of vertebrate cells. ; apical junction complex : A functional unit located near the cell apex at the points of contact between epithelial cells, which in vertebrates is composed of the tight junction, the zonula adherens, and desmosomes and in some invertebrates, such as Drosophila, is composed of the subapical complex (SAC), the zonula adherens and the septate junction. Functions in the regulation of cell polarity, tissue integrity and intercellular adhesion and permeability. ; apical part of cell : The region of a polarized cell that forms a tip or is distal to a base. For example, in a polarized epithelial cell, the apical region has an exposed surface and lies opposite to the basal lamina that separates the epithelium from other tissue. ; glial cell projection : A prolongation or process extending from a glial cell. ; : ;


Symbol
CRB1
Name
crumbs cell polarity complex component 1
Entrez ID
23418
Ensembl ID
ENSG00000134376    (more details)
KEGG ID
hsa:23418    (more details)
OMIM ID
172870
Uniprot ID
P82279  
GO ID
hsa:23418    (more details)
Chromosome
17
Strand
1
Start
28546708
End
28552631
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-373-3p (RPM: 0.0958) / hsa-miR-18b-5p (RPM: 0.3398) / hsa-miR-18a-5p (RPM: 3.6074) / hsa-miR-323a-5p (RPM: 0.534) / hsa-miR-4735-3p (RPM: 0.0052) / hsa-miR-561-3p (RPM: 0.023) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-4477b (RPM: 0.0392) / hsa-miR-7856-5p (RPM: 0.003) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Hippo signaling pathway /
Sequence
ATGGCACTTAAGAACATTAACTACCTTCTCATCTTCTACCTCAGTTTCTCACTGCTTATCTACATAAAAAATTCCTTTTGCAATAAAAACAACACCAGGTGCCTCTCAAATTCTTGCCAAAACAATTCTACATGCAAAGATTTTTCAAAAGACAATGATTGTTCTTGTTCAGACACAGCCAATAATTTGGACAAAGACTGTGACAACATGAAAGACCCTTGCTTCTCCAATCCCTGTCAAGGAAGTGCCACTTGTGTGAACACCCCAGGAGAAAGGAGCTTTCTGTGCAAATGTCCTCCTGGGTACAGTGGGACAATCTGTGAAACTACCATTGGTTCCTGTGGCAAGAACTCCTGCCAACATGGAGGTATTTGCCATCAGGACCCTATTTATCCTGTCTGCATCTGCCCTGCTGGATATGCTGGAAGATTCTGTGAGATAGATCACGATGAGTGTGCTTCCAGCCCTTGCCAAAATGGGGCCGTGTGCCAGGATGGAATTGATGGTTACTCCTGCTTCTGTGTCCCAGGATATCAAGGCAGACACTGCGACTTGGAAGTGGATGAATGTGCTTCAGATCCCTGCAAGAACGAGGCTACATGCCTCAATGAAATAGGAAGATATACTTGTATCTGTCCCCACAATTATTCTGGTGTAAACTGTGAATTGGAAATTGACGAATGTTGGTCCCAGCCTTGTTTAAATGGTGCAACTTGTCAGGATGCTCTGGGGGCCTATTTCTGCGACTGTGCCCCTGGATTCCTGGGGGATCACTGTGAACTCAACACTGATGAGTGTGCCAGTCAACCTTGTCTCCATGGAGGGCTGTGTGTGGATGGAGAAAACAGATATAGCTGTAACTGCACGGGTAGTGGATTCACAGGGACACACTGTGAGACCTTGATGCCTCTTTGTTGGTCAAAACCTTGTCACAATAATGCTACATGTGAGGACAGTGTTGACAATTACACTTGTCACTGCTGGCCTGGATACACAGGTGCCCAGTGTGAGATCGACCTCAATGAATGCAATAGTAACCCCTGCCAGTCCAATGGGGAATGTGTGGAGCTGTCCTCAGAGAAACAATATGGACGCATCACTGGACTGCCTTCTTCTTTCAGCTACCATGAAGCCTCAGGTTATGTCTGTATCTGTCAGCCTGGATTCACAGGAATCCACTGCGAAGAAGACGTCAATGAATGTTCTTCAAACCCTTGCCAAAATGGTGGTACTTGTGAGAACTTGCCTGGGAATTATACTTGCCATTGCCCATTTGATAACCTTTCTAGAACTTTTTATGGAGGAAGGGACTGTTCTGATATTCTCCTGGGCTGTACCCATCAGCAATGTCTAAATAATGGAACATGCATCCCTCACTTCCAAGATGGCCAGCATGGATTCAGCTGCCTATGTCCATCTGGCTACACCGGGTCCCTGTGTGAAATCGCAACCACACTTTCATTTGAGGGCGATGGCTTCCTGTGGGTCAAAAGTGGCTCAGTGACAACCAAGGGCTCAGTTTGTAACATAGCCCTCAGGTTTCAGACTGTTCAGCCAATGGCTCTTCTACTTTTCCGAAGCAACAGGGATGTGTTTGTGAAGCTGGAGCTGCTAAGTGGCTACATTCACTTATCAATTCAGGTCAATAATCAGTCAAAGGTGCTTCTGTTCATTTCCCACAACACCAGCGATGGAGAGTGGCATTTCGTGGAGGTAATATTTGCAGAGGCTGTGACCCTTACCTTAATCGACGACTCCTGTAAGGAGAAATGCATCGCGAAAGCTCCTACTCCACTTGAAAGTGATCAATCAATATGTGCTTTTCAGAACTCCTTTTTGGGTGGTTTACCAGTGGGAATGACCAGCAATGGTGTTGCTCTGCTTAACTTCTATAATATGCCATCCACACCTTCGTTTGTAGGCTGTCTCCAAGACATTAAAATTGATTGGAATCACATTACCCTGGAGAACATCTCGTCTGGCTCATCATTAAATGTCAAGGCAGGCTGTGTGAGAAAGGATTGGTGTGAAAGCCAACCTTGTCAAAGCAGAGGACGCTGCATCAACTTGTGGCTGAGTTACCAGTGTGACTGCCACAGGCCCTATGAAGGCCCCAACTGTCTGAGAGAGTATGTGGCAGGCAGATTTGGCCAGGATGACTCCACTGGTTATGTCATCTTTACTCTTGATGAGAGCTATGGAGACACCATCAGCCTCTCCATGTTTGTCCGAACGCTTCAACCATCAGGCTTACTTCTAGCTTTGGAAAACAGCACTTATCAATATATCCGTGTCTGGCTAGAGCGCGGCAGACTAGCAATGCTGACTCCAAACTCTCCCAAATTAGTAGTAAAATTTGTTCTTAATGATGGAAATGTCCACTTGATATCTTTGAAAATCAAGCCATATAAAATTGAACTGTATCAGTCTTCACAAAACCTAGGATTTATTTCTGCTTCTACGTGGAAAATCGAAAAGGGAGATGTCATCTACATTGGTGGCCTACCTGACAAGCAAGAGACTGAACTTAATGGTGGATTCTTCAAAGGCTGTATCCAAGATGTAAGACTAAACAACCAAAATCTGGAATTCTTTCCAAATCCAACAAACAATGCATCTCTCAATCCAGTTCTTGTCAATGTAACCCAAGGCTGTGCTGGAGACAACAGCTGCAAGTCCAACCCCTGTCACAATGGAGGTGTTTGCCATTCCCGGTGGGATGACTTCTCCTGTTCCTGTCCTGCCCTCACAAGTGGGAAAGCCTGTGAGGAGGTTCAGTGGTGTGGATTCAGCCCGTGTCCTCACGGAGCCCAGTGCCAGCCGGTGCTTCAAGGATTTGAATGTATTGCAAATGCTGTTTTTAATGGACAAAGCGGTCAAATATTATTCAGAAGCAATGGGAATATTACCAGAGAACTCACCAATATCACATTTGGTTTCAGAACAAGGGATGCAAATGTAATAATATTGCATGCAGAAAAAGAGCCTGAATTTCTTAATATTAGCATTCAAGATTCCAGATTATTCTTTCAATTGCAAAGTGGCAACAGCTTTTATATGCTAAGTCTGACAAGTTTGCAGTCAGTGAATGATGGCACATGGCACGAAGTGACCCTTTCCATGACAGACCCACTGTCCCAGACCTCCAGGTGGCAAATGGAAGTGGACAACGAAACACCTTTTGTGACCAGCACAATTGCTACTGGAAGCCTCAACTTTTTGAAGGATAATACAGATATTTATGTGGGAGACAGAGCTATTGACAATATAAAGGGCCTGCAAGGGTGTCTAAGTACAATAGAAATCGGAGGCATTTATCTCTCTTACTTTGAAAATGTTCATGGTTTCATTAATAAACCTCAGGAAGAGCAATTTCTCAAAATCTCTACCAATTCAGTGGTCACTGGCTGTTTGCAGTTAAATGTCTGCAACTCCAACCCCTGTTTGCATGGAGGAAACTGTGAAGACATCTATAGCTCTTATCATTGCTCCTGTCCCTTGGGATGGTCAGGGAAACACTGTGAACTCAACATCGATGAATGCTTTTCAAACCCCTGTATCCATGGCAACTGCTCTGACAGAGTTGCAGCCTACCACTGCACATGTGAGCCTGGATACACTGGTGTGAACTGTGAAGTGGATATAGACAACTGCCAGAGTCACCAGTGTGCAAATGGAGCCACCTGCATTAGTCATACTAATGGCTATTCTTGCCTCTGTTTTGGAAATTTTACAGGAAAATTTTGCAGACAGAGCAGATTACCCTCAACAGTCTGTGGGAATGAGAAGACAAATCTCACTTGCTACAATGGAGGCAACTGCACAGAGTTCCAGACTGAATTAAAATGTATGTGCCGGCCAGGTTTTACTGGAGAATGGTGTGAAAAGGACATTGATGAGTGTGCCTCTGATCCGTGTGTCAATGGAGGTCTGTGCCAGGACTTACTCAACAAATTCCAGTGCCTCTGTGATGTTGCCTTTGCTGGCGAGCGCTGCGAGGTGGACTTGGCAGATGACTTGATCTCCGACATTTTCACCACTATTGGCTCAGTGACTGTCGCCTTGTTACTGATCCTCTTGCTGGCCATTGTTGCTTCTGTTGTCACCTCCAACAAAAGGGCAACTCAGGGAACCTACAGCCCCAGCCGTCAGGAGAAGGAGGGCTCCCGAGTGGAAATGTGGAACTTGATGCCACCCCCTGCAATGGAGAGACTGATTTAG

Back to List