Details for gene: ARL2BP


nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; mitochondrion : A semiautonomous, self replicating organelle that occurs in varying numbers, shapes, and sizes in the cytoplasm of virtually all eukaryotic cells. It is notably the site of tissue respiration. ; regulation of catalytic activity : Any process that modulates the activity of an enzyme. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; positive regulation of transcription, DNA-templated : Any process that activates or increases the frequency, rate or extent of cellular DNA-templated transcription. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; mitochondrial intermembrane space : The region between the inner and outer lipid bilayers of the mitochondrial envelope. ; microtubule organizing center : An intracellular structure that can catalyze gamma-tubulin-dependent microtubule nucleation and that can anchor microtubules by interacting with their minus ends, plus ends or sides. ; spindle : The array of microtubules and associated molecules that forms between opposite poles of a eukaryotic cell during mitosis or meiosis and serves to move the duplicated chromosomes apart. ; membrane-bounded organelle : Organized structure of distinctive morphology and function, bounded by a single or double lipid bilayer membrane. Includes the nucleus, mitochondria, plastids, vacuoles, and vesicles. Excludes the plasma membrane. ; midbody : A thin cytoplasmic bridge formed between daughter cells at the end of cytokinesis. The midbody forms where the contractile ring constricts, and may persist for some time before finally breaking to complete cytokinesis. ; transcription coactivator activity : A transcription coregulator activity that activates or increases the transcription of specific gene sets via binding to a DNA-bound DNA-binding transcription factor, either on its own or as part of a complex. Coactivators often act by altering chromatin structure and modifications. For example, one class of transcription coactivators modifies chromatin structure through covalent modification of histones. A second class remodels the conformation of chromatin in an ATP-dependent fashion. A third class modulates interactions of DNA-bound DNA-binding transcription factors with other transcription coregulators. A fourth class of coactivator activity is the bridging of a DNA-binding transcription factor to the general (basal) transcription machinery. The Mediator complex, which bridges sequence-specific DNA binding transcription factors and RNA polymerase, is also a transcription coactivator. ; centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ; positive regulation of tyrosine phosphorylation of STAT protein : Any process that activates or increases the frequency, rate or extent of the introduction of a phosphate group to a tyrosine residue of a STAT (Signal Transducer and Activator of Transcription) protein. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; mitochondrial matrix : The gel-like material, with considerable fine structure, that lies in the matrix space, or lumen, of a mitochondrion. It contains the enzymes of the tricarboxylic acid cycle and, in some organisms, the enzymes concerned with fatty acid oxidation. ; signal transduction : The cellular process in which a signal is conveyed to trigger a change in the activity or state of a cell. Signal transduction begins with reception of a signal (e.g. a ligand binding to a receptor or receptor activation by a stimulus such as light), or for signal transduction in the absence of ligand, signal-withdrawal or the activity of a constitutively active receptor. Signal transduction ends with regulation of a downstream cellular process, e.g. regulation of transcription or regulation of a metabolic process. Signal transduction covers signaling from receptors located on the surface of the cell and signaling via molecules located within the cell. For signaling between cells, signal transduction is restricted to events at and within the receiving cell. ; GTPase regulator activity : Binds to and modulates the activity of a GTPase. ; maintenance of protein location in nucleus : Any process in which a protein is maintained in the nucleus and prevented from moving elsewhere. These include sequestration within the nucleus, protein stabilization to prevent transport elsewhere and the active retrieval of proteins that escape the nucleus. ;


Symbol
ARL2BP
Name
ADP ribosylation factor like GTPase 2 binding protein
Entrez ID
23568
Ensembl ID
ENSG00000102931    (more details)
KEGG ID
hsa:23568    (more details)
OMIM ID
615407
Uniprot ID
A0A024R6U9  
GO ID
hsa:23568    (more details)
Chromosome
1
Strand
1
Start
215622891
End
216423448
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-101-3p (RPM: 3335.0564) / hsa-miR-1290 (RPM: 0.1162) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-495-3p (RPM: 8.062) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-miR-603 (RPM: 0.0052) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-369-3p (RPM: 7.3414) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-miR-30e-3p (RPM: 538.304) / hsa-miR-30a-3p (RPM: 889.1386) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-30d-3p (RPM: 57.136) / hsa-miR-939-5p (RPM: 0.5712) / hsa-miR-3065-3p (RPM: 17.8542) / hsa-miR-494-3p (RPM: 1.1806) / hsa-miR-21-5p (RPM: 5494.851) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-181d-5p (RPM: 168.2728) / hsa-miR-181b-5p (RPM: 3069.8278) / hsa-miR-181c-5p (RPM: 1285.07) / hsa-miR-181a-5p (RPM: 52364.6344) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-378a-3p (RPM: 1540.7796) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-140-3p (RPM: 779.3088) / hsa-miR-491-5p (RPM: 1.4644) / hsa-miR-545-3p (RPM: 0.0276) / hsa-miR-215-5p (RPM: 12.4448) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-192-5p (RPM: 3146.8498) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Regulation of insulin secretion /
Sequence
ATGGACGCCTTAGAAGGAGAGAGCTTTGCGCTGTCTTTCTCCTCCGCCTCTGATGCAGAATTTGATGCTGTGGTTGGATATTTAGAGGACATTATCATGGATGACGAGTTCCAGTTATTACAGAGAAATTTCATGGACAAGTACTACCTGGAGTTTGAAGACACAGAAGAGAATAAACTCATCTACACACCTATTTTTAATGAATACATTTCTTTGGTAGAAAAATACATTGAAGAACAGCTGCTGCAGCGGATTCCTGAGTTCAACATGGCAGCCTTCACCACAACATTACAGCACCATAAGGATGAAGTGGCTGGTGACATATTCGACATGCTGCTCACCTTCACAGATTTTCTGGCTTTTAAAGAAATGTTTTTGGACTACAGAGCAGAAAAAGAAGGCCGAGGACTGGACTTAAGCAGTGGCTTAGTGGTGACTTCATTGTGCAAATCATCTTCTCTGCCAGCTTCCCAGAACAATCTGCGGCACTAG

Back to List