Details for gene: AIPL1


peptidyl-prolyl cis-trans isomerase activity : Catalysis of the reaction: peptidyl-proline (omega=180) = peptidyl-proline (omega=0). ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; protein peptidyl-prolyl isomerization : The modification of a protein by cis-trans isomerization of a proline residue. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; response to stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a stimulus. The process begins with detection of the stimulus and ends with a change in state or activity or the cell or organism. ; retina homeostasis : A tissue homeostatic process involved in the maintenance of an internal equilibrium within the retina of the eye, including control of cellular proliferation and death and control of metabolic function. ; phototransduction, visible light : The sequence of reactions within a cell required to convert absorbed photons from visible light into a molecular signal. A visible light stimulus is electromagnetic radiation that can be perceived visually by an organism; for organisms lacking a visual system, this can be defined as light with a wavelength within the range 380 to 780 nm. ; regulation of rhodopsin mediated signaling pathway : Any process that modulates the frequency, rate or extent of rhodopsin-mediated signaling. ; negative regulation of apoptotic process : Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process. ; photoreceptor inner segment : The inner segment of a vertebrate photoreceptor containing mitochondria, ribosomes and membranes where opsin molecules are assembled and passed to be part of the outer segment discs. ; unfolded protein binding : Interacting selectively and non-covalently with an unfolded protein. ; protein farnesylation : The covalent attachment of a farnesyl group to a protein. ; farnesylated protein binding : Interacting selectively and non-covalently with a farnesylated protein. ;


Symbol
AIPL1
Name
aryl hydrocarbon receptor interacting protein like 1
Entrez ID
23746
Ensembl ID
ENSG00000129221    (more details)
KEGG ID
hsa:23746    (more details)
OMIM ID
268000
Uniprot ID
F1T0B6  
GO ID
hsa:23746    (more details)
Chromosome
20
Strand
-1
Start
25294742
End
25390835
miRNA Interactions
hsa-miR-147a (RPM: 0.0014) / hsa-miR-4705 (RPM: 0.444) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-4726-3p (RPM: 0.0088) / hsa-miR-3615 (RPM: 64.4484) / hsa-miR-2681-5p (RPM: 0.1438) / hsa-miR-6778-3p (RPM: 0.0066) / hsa-miR-6764-5p (RPM: 0.111) / hsa-miR-4485-5p (RPM: 0.143) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGGATGCCGCTCTGCTCCTGAACGTGGAAGGGGTCAAGAAAACCATTCTGCACGGGGGCACGGGCGAGCTCCCAAACTTCATCACCGGATCCCGAGTGATCTTTCATTTCCGCACCATGAAATGTGATGAGGAGCGGACAGTCATTGACGACAGTCGGCAGGTGGGCCAGCCCATGCACATCATCATCGGAAACATGTTCAAGCTCGAGGTCTGGGAGATCCTGCTTACCTCCATGCGGGTGCACGAGGTGGCCGAGTTCTGGTGCGACACCATCCACACGGGGGTCTACCCCATCCTATCCCGGAGCCTGAGGCAGATGGCCCAGGGCAAGGACCCCACAGAGTGGCACGTGCACACGTGCGGGCTGGCCAACATGTTCGCCTACCACACGCTGGGCTACGAGGACCTGGACGAGCTGCAGAAGGAGCCTCAGCCTCTGGTCTTTGTGATCGAGCTGCTGCAGGTTGATGCCCCGAGTGATTACCAGAGGGAGACCTGGAACCTGAGCAATCATGAGAAGATGAAGGCGGTGCCCGTCCTCCACGGAGAGGGAAATCGGCTCTTCAAGCTGGGCCGCTACGAGGAGGCCTCTTCCAAGTACCAGGAGGCCATCATCTGCCTAAGGAACCTGCAGACCAAGGAGAAGCCATGGGAGGTGCAGTGGCTGAAGCTGGAGAAGATGATCAATACTCTGATCCTCAACTACTGCCAGTGCCTGCTGAAGAAGGAGGAGTACTATGAGGTGCTGGAGCACACCAGTGATATTCTCCGGCACCACCCAGGCATCGTGAAGGCCTACTACGTGCGTGCCCGGGCTCACGCAGAGGTGTGGAATGAGGCCGAGGCCAAGGCGGACCTCCAGAAAGTGCTGGAGCTGGAGCCGTCCATGCAGAAGGCGGTGCGCAGGGAGCTGAGGCTGCTGGAGAACCGCATGGCGGAGAAGCAGGAGGAGGAGCGGCTGCGCTGCCGGAACATGCTGAGCCAGGGTGCCACGCAGCCTCCCGCAGAGCCACCCACAGAGCCACCCGCACAGTCATCCACAGAGCCACCTGCAGAGCCACCCACAGCACCATCTGCAGAGCTGTCCGCAGGGCCCCCTGCAGAGCCAGCCACAGAGCCACCCCCGTCCCCAGGGCACTCGCTGCAGCACTGA

Back to List