Details for gene: PRPF6


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; RNA processing : Any process involved in the conversion of one or more primary RNA transcripts into one or more mature RNA molecules. ; mRNA splicing, via spliceosome : The joining together of exons from one or more primary transcripts of messenger RNA (mRNA) and the excision of intron sequences, via a spliceosomal mechanism, so that mRNA consisting only of the joined exons is produced. ; RNA binding : Interacting selectively and non-covalently with an RNA molecule or a portion thereof. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; spliceosomal complex : Any of a series of ribonucleoprotein complexes that contain snRNA(s) and small nuclear ribonucleoproteins (snRNPs), and are formed sequentially during the spliceosomal splicing of one or more substrate RNAs, and which also contain the RNA substrate(s) from the initial target RNAs of splicing, the splicing intermediate RNA(s), to the final RNA products. During cis-splicing, the initial target RNA is a single, contiguous RNA transcript, whether mRNA, snoRNA, etc., and the released products are a spliced RNA and an excised intron, generally as a lariat structure. During trans-splicing, there are two initial substrate RNAs, the spliced leader RNA and a pre-mRNA. ; mRNA processing : Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide. ; RNA splicing : The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA. ; nuclear speck : A discrete extra-nucleolar subnuclear domain, 20-50 in number, in which splicing factors are seen to be localized by immunofluorescence microscopy. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; catalytic step 2 spliceosome : A spliceosomal complex that contains three snRNPs, including U5, bound to a splicing intermediate in which the first catalytic cleavage of the 5' splice site has occurred. The precise subunit composition differs significantly from that of the catalytic step 1, or activated, spliceosome, and includes many proteins in addition to those found in the associated snRNPs. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; spliceosomal complex assembly : The aggregation, arrangement and bonding together of a spliceosomal complex, a ribonucleoprotein apparatus that catalyzes nuclear mRNA splicing via transesterification reactions. ; U4/U6 x U5 tri-snRNP complex : A ribonucleoprotein complex that is formed by the association of the U4/U6 and U5 snRNPs. ; positive regulation of transcription by RNA polymerase II : Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter. ; RNA splicing, via transesterification reactions : Splicing of RNA via a series of two transesterification reactions. ; U2-type precatalytic spliceosome : A spliceosomal complex that is formed by the recruitment of the preassembled U4/U6.U5 tri-snRNP to the prespliceosome. Although all 5 snRNPs are present, the precatalytic spliceosome is catalytically inactive. The precatalytic spliceosome includes many proteins in addition to those found in the U1, U2 and U4/U6.U5 snRNPs. ; ribonucleoprotein complex binding : Interacting selectively and non-covalently with any complex of RNA and protein. ; transcription coactivator activity : A transcription coregulator activity that activates or increases the transcription of specific gene sets via binding to a DNA-bound DNA-binding transcription factor, either on its own or as part of a complex. Coactivators often act by altering chromatin structure and modifications. For example, one class of transcription coactivators modifies chromatin structure through covalent modification of histones. A second class remodels the conformation of chromatin in an ATP-dependent fashion. A third class modulates interactions of DNA-bound DNA-binding transcription factors with other transcription coregulators. A fourth class of coactivator activity is the bridging of a DNA-binding transcription factor to the general (basal) transcription machinery. The Mediator complex, which bridges sequence-specific DNA binding transcription factors and RNA polymerase, is also a transcription coactivator. ; RNA localization : A process in which RNA is transported to, or maintained in, a specific location. ; androgen receptor binding : Interacting selectively and non-covalently with an androgen receptor. ; spliceosomal tri-snRNP complex assembly : The formation of a tri-snRNP complex containing U4 and U6 (or U4atac and U6atac) snRNAs and U5 snRNAs and associated proteins. This includes reannealing of U4 and U6 (or U4atac and U6atac) snRNAs released from previous rounds of splicing to reform the U4/U6 snRNP (or U4atac/U6atac snRNP) as well as the subsequent association of the U5 snRNP with the U4/U6 snRNP (or U4atac/U6atac snRNP) to form a tri-snRNP that is ready to reassemble into another spliceosome complex. ; U5 snRNP : A ribonucleoprotein complex that contains small nuclear RNA U5, a heptameric ring of Sm proteins, as well as several proteins that are unique to the U5 snRNP, most of which remain associated with the U5 snRNA both while the U5 snRNP is free or assembled into a series of spliceosomal complexes. ;


Symbol
PRPF6
Name
pre-mRNA processing factor 6
Entrez ID
24148
Ensembl ID
ENSG00000101161    (more details)
KEGG ID
hsa:24148    (more details)
OMIM ID
613979
Uniprot ID
O94906  
GO ID
hsa:24148    (more details)
Chromosome
2
Strand
1
Start
27042364
End
27070622
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-548x-3p (RPM: 0.0064) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-765 (RPM: 0.4272) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-3194-3p (RPM: 0.0228) / hsa-miR-103a-3p (RPM: 2034.8158) / hsa-miR-149-5p (RPM: 312.3098) / hsa-miR-1226-3p (RPM: 2.778) / hsa-miR-939-5p (RPM: 0.5712) / hsa-miR-301a-5p (RPM: 0.6676) / hsa-miR-500a-5p (RPM: 1.3064) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-873-5p (RPM: 18.2502) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-30c-2-3p (RPM: 52.8714) / hsa-miR-30b-3p (RPM: 13.9872) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-221-5p (RPM: 32.1456) / hsa-miR-4284 (RPM: 0.1674) / hsa-miR-30c-1-3p (RPM: 36.5546) / hsa-miR-615-3p (RPM: 0.1424) / hsa-miR-361-3p (RPM: 73.5598) / hsa-miR-675-5p (RPM: 0.6068) / hsa-miR-181a-2-3p (RPM: 1451.5764) / hsa-miR-4798-3p (RPM: 0.001) / hsa-miR-4746-3p (RPM: 0.0012) / hsa-miR-663a (RPM: 0.1414) / hsa-miR-7977 (RPM: 18.3058) / hsa-miR-6750-3p (RPM: 0.1284) / hsa-miR-383-3p (RPM: 0.0168) / hsa-miR-4466 (RPM: 0.2402) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Spliceosome /
Sequence
ATGAACAAGAAGAAGAAACCGTTCCTAGGGATGCCCGCGCCCCTCGGCTACGTGCCGGGGCTGGGCCGGGGCGCCACTGGCTTCACCACGCGGTCAGACATTGGGCCCGCCCGTGATGCAAATGACCCTGTGGATGATCGCCATGCACCCCCAGGCAAGAGAACCGTTGGGGACCAGATGAAGAAAAATCAGGCTGCTGACGATGACGACGAGGATCTAAATGACACCAATTACGATGAGTTTAATGGCTATGCTGGGAGCCTCTTCTCAAGTGGACCCTACGAGAAAGATGATGAGGAAGCAGATGCTATCTATGCAGCCCTGGATAAAAGGATGGATGAAAGAAGAAAAGAAAGACGGGAGCAAAGGGAGAAAGAAGAAATAGAGAAATATCGTATGGAACGCCCCAAAATCCAACAGCAGTTCTCAGACCTCAAGAGGAAGTTGGCAGAAGTCACAGAAGAAGAGTGGCTGAGCATCCCCGAGGTTGGCGATGCCAGAAATAAACGTCAGCGGAACCCACGCTATGAGAAGCTGACCCCTGTTCCTGACAGTTTCTTTGCCAAACATTTACAGACCGGAGAGAACCATACCTCAGTGGATCCCCGACAAACTCAATTTGGAGGTCTTAACACACCCTATCCAGGTGGACTAAACACTCCATACCCAGGTGGAATGACGCCAGGACTGATGACACCTGGCACAGGTGAGCTGGACATGAGGAAGATTGGCCAAGCGAGGAACACTCTGATGGACATGAGGCTGAGCCAGGTGTCTGACTCCGTGAGTGGACAGACCGTCGTTGACCCCAAAGGCTACCTGACGGATTTAAATTCCATGATCCCGACACACGGAGGAGACATCAATGATATCAAGAAGGCGCGACTGCTCCTCAAGTCTGTTCGGGAGACGAACCCTCATCACCCGCCAGCCTGGATTGCATCAGCCCGCCTGGAAGAAGTCACTGGGAAGCTACAAGTAGCTCGGAACCTTATCATGAAGGGGACGGAGATGTGCCCCAAGAGTGAAGATGTCTGGCTGGAAGCAGCCAGGTTGCAGCCTGGGGACACAGCCAAGGCCGTGGTAGCCCAAGCTGTCCGTCATCTCCCACAGTCTGTCAGGATTTACATCAGAGCCGCAGAGCTGGAAACGGACATTCGTGCAAAGAAGCGGGTTCTTCGGAAAGCCCTCGAGCATGTTCCAAACTCGGTTCGCTTGTGGAAAGCAGCCGTTGAGCTGGAAGAACCTGAAGATGCTAGAATCATGCTGAGCCGAGCTGTGGAGTGCTGCCCCACCAGCGTGGAGCTCTGGCTTGCTCTGGCAAGGCTGGAGACCTATGAAAATGCCCGCAAGGTCTTGAACAAGGCGCGGGAGAACATTCCTACAGACCGACATATCTGGATCACGGCTGCTAAGCTGGAGGAAGCCAATGGGAACACGCAGATGGTGGAGAAGATCATCGACCGAGCCATCACCTCGCTGCGGGCCAACGGTGTGGAGATCAACCGTGAGCAGTGGATCCAGGATGCCGAGGAATGTGACAGGGCTGGGAGTGTGGCCACCTGCCAGGCCGTCATGCGTGCCGTGATTGGGATTGGGATTGAGGAGGAAGATCGGAAGCATACCTGGATGGAGGATGCTGACAGTTGTGTAGCCCACAATGCCCTGGAGTGTGCACGAGCCATCTACGCCTACGCCCTGCAGGTGTTCCCCAGCAAGAAGAGTGTGTGGCTGCGCGCCGCGTACTTCGAGAAGAACCATGGCACTCGGGAGTCCCTGGAAGCACTCCTGCAGAGGGCTGTGGCCCACTGCCCCAAAGCAGAGGTGCTGTGGCTCATGGGCGCCAAGTCCAAGTGGCTGGCAGGGGATGTGCCTGCAGCAAGGAGCATCCTGGCCCTGGCCTTCCAGGCCAACCCCAACAGTGAGGAGATCTGGCTGGCAGCCGTGAAGCTGGAGTCCGAGAATGATGAGTACGAGCGGGCCCGGAGGCTGCTGGCCAAGGCGCGGAGCAGTGCCCCCACCGCCCGGGTGTTCATGAAGTCTGTGAAGCTGGAGTGGGTGCAAGACAACATCAGGGCAGCCCAAGATCTGTGCGAGGAGGCCCTGCGGCACTATGAGGACTTCCCCAAGCTGTGGATGATGAAGGGGCAGATCGAGGAGCAGAAGGAGATGATGGAGAAGGCGCGGGAAGCCTATAACCAGGGGTTGAAGAAGTGTCCCCACTCCACACCCCTGTGGCTTTTGCTCTCTCGGCTGGAGGAGAAGATTGGGCAGCTTACTCGAGCACGGGCCATTTTGGAAAAGTCTCGTCTGAAGAACCCAAAGAACCCTGGGCTGTGGTTGGAGTCCGTGCGGCTGGAGTACCGTGCGGGGCTGAAGAACATCGCAAATACACTCATGGCCAAGGCGCTGCAGGAGTGCCCCAACTCCGGTATCCTGTGGTCTGAGGCCATCTTCCTCGAGGCAAGGCCCCAGAGGAGGACCAAGAGCGTGGATGCCCTGAAGAAGTGTGAGCATGACCCCCATGTGCTCCTGGCCGTGGCCAAGCTGTTTTGGAGTCAGCGGAAGATCACCAAGGCCAGGGAGTGGTTCCACCGCACTGTGAAGATTGACTCGGACCTGGGGGATGCCTGGGCCTTCTTCTACAAGTTTGAGCTGCAGCATGGCACTGAGGAGCAGCAGGAGGAGGTGAGGAAGCGCTGTGAGAGTGCAGAGCCTCGGCATGGGGAGCTGTGGTGCGCCGTGTCCAAGGACATCGCCAACTGGCAGAAGAAGATCGGGGACATCCTTAGGCTGGTGGCCGGCCGCATCAAGAACACCTTCTGA

Back to List