Details for gene: FSCN2


actin filament binding : Interacting selectively and non-covalently with an actin filament, also known as F-actin, a helical filamentous polymer of globular G-actin subunits. ; actin filament organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of cytoskeletal structures comprising actin filaments. Includes processes that control the spatial distribution of actin filaments, such as organizing filaments into meshworks, bundles, or other structures, as by cross-linking. ; actin cytoskeleton organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of cytoskeletal structures comprising actin filaments and their associated proteins. ; protein-macromolecule adaptor activity : The binding activity of a protein that brings together two or more macromolecules in contact, permitting those molecules to function in a coordinated way. The adaptor can bring together two proteins, or a protein and another macromolecule such as a lipid or a nucleic acid. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; actin binding : Interacting selectively and non-covalently with monomeric or multimeric forms of actin, including actin filaments. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; stereocilium : An actin-based protrusion from the apical surface of auditory and vestibular hair cells and of neuromast cells. These protrusions are supported by a bundle of cross-linked actin filaments (an actin cable), oriented such that the plus (barbed) ends are at the tip of the protrusion, capped by a tip complex which bridges to the plasma. Bundles of stereocilia act as mechanosensory organelles. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; cell migration : The controlled self-propelled movement of a cell from one site to a destination guided by molecular cues. Cell migration is a central process in the development and maintenance of multicellular organisms. ; actin cytoskeleton : The part of the cytoskeleton (the internal framework of a cell) composed of actin and associated proteins. Includes actin cytoskeleton-associated complexes. ; actin filament bundle assembly : The assembly of actin filament bundles; actin filaments are on the same axis but may be oriented with the same or opposite polarities and may be packed with different levels of tightness. ; visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; establishment or maintenance of cell polarity : Any cellular process that results in the specification, formation or maintenance of anisotropic intracellular organization or cell growth patterns. ; anatomical structure morphogenesis : The process in which anatomical structures are generated and organized. Morphogenesis pertains to the creation of form. ; eye photoreceptor cell development : Development of a photoreceptor, a sensory cell in the eye that reacts to the presence of light. They usually contain a pigment that undergoes a chemical change when light is absorbed, thus stimulating a nerve. ;


Symbol
FSCN2
Name
fascin actin-bundling protein 2, retinal
Entrez ID
25794
Ensembl ID
ENSG00000186765    (more details)
KEGG ID
hsa:25794    (more details)
OMIM ID
607643
Uniprot ID
O14926  
GO ID
hsa:25794    (more details)
Chromosome
6
Strand
1
Start
135283407
End
135498434
miRNA Interactions
hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-200b-3p (RPM: 566.8348) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-335-5p (RPM: 265.7294) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGCCGACGAACGGCCTGCACCAGGTGCTGAAGATCCAGTTTGGCCTCGTCAACGACACTGACCGCTACCTGACAGCTGAGAGCTTCGGCTTCAAGGTCAATGCCTCGGCACCCAGCCTCAAGAGGAAGCAGACCTGGGTGCTGGAACCCGACCCAGGACAAGGCACGGCTGTGCTGCTCCGCAGCAGCCACCTGGGCCGCTACCTGTCGGCAGAAGAGGACGGGCGCGTGGCCTGTGAGGCAGAGCAGCCGGGCCGTGACTGCCGCTTCCTGGTCCTGCCGCAGCCAGATGGGCGCTGGGTGCTGCGGTCCGAGCCGCACGGCCGCTTCTTCGGAGGCACCGAGGACCAGCTGTCCTGCTTCGCCACAGCCGTTTCCCCGGCCGAGCTGTGGACCGTGCACCTGGCCATCCACCCGCAGGCCCACCTGCTGAGCGTGAGCCGGCGGCGCTACGTGCACCTGTGCCCGCGGGAGGACGAGATGGCCGCAGACGGAGACAAGCCCTGGGGCGTGGACGCCCTCCTCACCCTCATCTTCCGGAGCCGACGGTACTGCCTCAAGTCCTGTGACAGCCGCTACCTGCGCAGCGACGGCCGTCTGGTCTGGGAGCCTGAGCCCCGTGCCTGCTACACGCTGGAGTTCAAGGCGGGCAAGCTGGCCTTCAAGGACTGCGACGGCCACTACCTGGCACCCGTGGGGCCCGCAGGCACCCTCAAGGCCGGCCGAAACACGCGACCTGGCAAGGATGAGCTCTTTGATCTGGAGGAGAGTCACCCACAGGTGGTGCTGGTGGCTGCCAACCACCGCTACGTCTCTGTGCGGCAAGGGGTCAACGTCTCAGCCAATCAGGATGATGAACTAGACCACGAGACCTTCCTGATGCAAATTGACCAGGAGACAAAGAAGTGCACCTTCTATTCCAGCACTGGGGGCTACTGGACCCTGGTCACCCATGGGGGCATTCACGCCACAGCCACACAAGTTTCTGCCAACACCATGTTTGAGATGGAGTGGCGTGGCCGGCGGGTAGCACTCAAAGCCAGCAACGGGCGCTACGTGTGCATGAAGAAGAATGGGCAGCTGGCGGCTATCAGCGATTTTGTCGGCAAGGACGAAGAGTTCACCCTCAAGCTCATCAACCGGCCCATCCTGGTGCTGCGCGGCCTGGACGGCTTCGTCTGCCACCACCGCGGCTCCAACCAGCTGGACACCAACCGCTCCGTCTACGACGTCTTCCACCTGAGCTTCAGCGACGGCGCCTACCGGATCCGAGGCCGCGACGGAGGGTTCTGGTACACGGGCAGCCACGGCAGCGTGTGCAGCGACGGCGAACGCGCCGAGGACTTCGTCTTCGAGTTCCGTGAGCGCGGCCGCCTGGCCATCCGCGCCCGGAGCGGCAAGTACCTGCGCGGCGGCGCCTCGGGCCTGCTGCGGGCCGATGCCGACGCCCCGGCCGGGACCGCGCTTTGGGAGTACTGA

Back to List