Details for gene: ABHD12


membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; endoplasmic reticulum membrane : The lipid bilayer surrounding the endoplasmic reticulum. ; acylglycerol lipase activity : Catalysis of the reaction: H2O + acylglycerol = a fatty acid + glycerol. ; lysophospholipase activity : Catalysis of the reaction: 2-lysophosphatidylcholine + H2O = glycerophosphocholine + a carboxylate. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; hydrolase activity : Catalysis of the hydrolysis of various bonds, e.g. C-O, C-N, C-C, phosphoric anhydride bonds, etc. Hydrolase is the systematic name for any enzyme of EC class 3. ; lipid metabolic process : The chemical reactions and pathways involving lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent. Includes fatty acids; neutral fats, other fatty-acid esters, and soaps; long-chain (fatty) alcohols and waxes; sphingoids and other long-chain bases; glycolipids, phospholipids and sphingolipids; and carotenes, polyprenols, sterols, terpenes and other isoprenoids. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; arachidonic acid metabolic process : The chemical reactions and pathways involving arachidonic acid, a straight chain fatty acid with 20 carbon atoms and four double bonds per molecule. Arachidonic acid is the all-Z-(5,8,11,14)-isomer. ; monoacylglycerol catabolic process : The chemical reactions and pathways resulting in the breakdown of monoacylglycerol, any ester of glycerol in which any one of its hydroxyl groups has been acylated with a fatty acid, the other being non-esterified. ; phospholipase activity : Catalysis of the hydrolysis of a glycerophospholipid. ; palmitoyl-(protein) hydrolase activity : Catalysis of the reaction: palmitoyl-protein + H2O = palmitate + protein. ; acylglycerol catabolic process : The chemical reactions and pathways resulting in the breakdown of acylglycerol, any mono-, di- or triester of glycerol with (one or more) fatty acids. ; phosphatidylserine catabolic process : The chemical reactions and pathways resulting in the breakdown of phosphatidylserines, any of a class of glycerophospholipids in which the phosphatidyl group is esterified to the hydroxyl group of L-serine. ; phospholipid catabolic process : The chemical reactions and pathways resulting in the breakdown of phospholipids, any lipid containing phosphoric acid as a mono- or diester. ; glycerophospholipid catabolic process : The chemical reactions and pathways resulting in the breakdown of glycerophospholipids, any derivative of glycerophosphate that contains at least one O-acyl, O-alkyl, or O-alkenyl group attached to the glycerol residue. ; protein depalmitoylation : The removal of palymitoyl groups from a lipoprotein. ; adult walking behavior : The behavior of an adult relating to the progression of that organism along the ground by the process of lifting and setting down each leg. ; response to auditory stimulus : Any process that results in a change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an auditory stimulus. ; regulation of inflammatory response : Any process that modulates the frequency, rate or extent of the inflammatory response, the immediate defensive reaction (by vertebrate tissue) to infection or injury caused by chemical or physical agents. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; AMPA glutamate receptor complex : An assembly of four or five subunits which form a structure with an extracellular N-terminus and a large loop that together form the ligand binding domain. The C-terminus is intracellular. The ionotropic glutamate receptor complex itself acts as a ligand gated ion channel; on binding glutamate, charged ions pass through a channel in the center of the receptor complex. The AMPA receptors mediate fast synaptic transmission in the CNS and are composed of subunits GluR1-4, products from separate genes. These subunits have an extracellular N-terminus and an intracellular C-terminus. ; dendrite cytoplasm : All of the contents of a dendrite, excluding the surrounding plasma membrane. ;


Symbol
ABHD12
Name
abhydrolase domain containing 12, lysophospholipase
Entrez ID
26090
Ensembl ID
ENSG00000100997    (more details)
KEGG ID
hsa:26090    (more details)
OMIM ID
612674
Uniprot ID
Q8N2K0  
GO ID
hsa:26090    (more details)
Chromosome
17
Strand
-1
Start
6393693
End
6435199
miRNA Interactions
hsa-miR-423-5p (RPM: 976.289) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-374a-5p (RPM: 52.6724) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-766-5p (RPM: 0.1124) / hsa-miR-450b-3p (RPM: 0.0026) / hsa-miR-150-5p (RPM: 64.1654) / hsa-miR-488-3p (RPM: 11.3394) / hsa-miR-484 (RPM: 434.5276) / hsa-miR-519b-3p (RPM: 0.0036) / hsa-miR-4753-5p (RPM: 0.097) / hsa-miR-519a-3p (RPM: 0.0036) / hsa-miR-519c-3p (RPM: 0.0096) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-302a-5p (RPM: 0.1518) / hsa-miR-4429 (RPM: 0.0238) / hsa-miR-4521 (RPM: 0.5154) / hsa-miR-320b (RPM: 35.0146) / hsa-miR-320c (RPM: 5.4174) / hsa-miR-320d (RPM: 3.9486) / hsa-let-7g-3p (RPM: 7.0448) / hsa-miR-1909-3p (RPM: 0.0524) / hsa-let-7a-2-3p (RPM: 0.3976) / hsa-miR-769-3p (RPM: 3.6276) / hsa-miR-622 (RPM: 0.0046) / hsa-miR-3177-5p (RPM: 0.1208) / hsa-miR-9-3p (RPM: 123.624) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-1910-5p (RPM: 8.4774) / hsa-miR-552-3p (RPM: 0.0608) / hsa-miR-2114-5p (RPM: 6.6774) / hsa-miR-182-3p (RPM: 20.9678) / hsa-miR-1247-3p (RPM: 20.5724) / hsa-miR-423-3p (RPM: 1928.5158) / hsa-miR-6825-5p (RPM: 0.261) / hsa-miR-6778-3p (RPM: 0.0066) / hsa-miR-7106-5p (RPM: 0.007) / hsa-miR-619-5p (RPM: 1.5814) / hsa-miR-6506-5p (RPM: 0.1086) / hsa-miR-6730-5p (RPM: 0.871) / hsa-miR-6802-5p (RPM: 0.0584) / hsa-miR-6800-5p (RPM: 0.0126) / hsa-miR-6132 (RPM: 0.1344) / hsa-miR-6836-5p (RPM: 0.347) / hsa-miR-4706 (RPM: 0.1162) / hsa-miR-4485-5p (RPM: 0.143) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Arachidonate production from DAG /
Sequence
ATGAGGAAGCGGACCGAGCCCGTCGCCTTGGAGCATGAGCGCTGCGCCGCCGCGGGCTCGTCCTCCTCCGGCTCGGCCGCCGCGGCGCTGGACGCCGACTGCCGCCTGAAGCAGAACCTACGCCTGACGGGCCCGGCGGCGGCTGAGCCGCGCTGCGCAGCCGACGCGGGAATGAAGCGGGCGCTGGGCAGGCGAAAGGGCGTGTGGTTGCGCCTGAGGAAGATACTTTTCTGTGTTTTGGGGTTGTACATTGCCATTCCATTTCTCATCAAACTATGTCCTGGAATACAGGCCAAACTGATTTTCTTGAATTTCGTAAGAGTTCCCTATTTCATTGATTTGAAAAAACCACAGGATCAAGGTTTGAATCACACGTGTAACTACTACCTGCAGCCAGAGGAAGACGTGACCATTGGAGTCTGGCACACCGTCCCTGCAGTCTGGTGGAAGAACGCCCAAGGCAAAGACCAGATGTGGTATGAGGATGCCTTGGCTTCCAGCCACCCTATCATTCTGTACCTGCATGGGAACGCAGGTACCAGAGGAGGCGACCACCGCGTGGAGCTTTACAAGGTGCTGAGTTCCCTTGGTTACCATGTGGTCACCTTTGACTACAGAGGTTGGGGTGACTCAGTGGGAACGCCATCTGAGCGGGGCATGACCTATGACGCACTCCACGTTTTTGACTGGATCAAAGCAAGAAGTGGTGACAACCCCGTGTACATCTGGGGCCACTCTCTGGGCACTGGCGTGGCGACAAATCTGGTGCGGCGCCTCTGTGAGCGAGAGACGCCTCCAGATGCCCTTATATTGGAATCTCCATTCACTAATATCCGCGAAGAAGCTAAGAGCCATCCATTTTCAGTGATATATCGATACTTCCCTGGGTTTGACTGGTTCTTCCTTGATCCTATTACAAGTAGTGGAATTAAATTTGCAAATGATGAAAACGTGAAGCACATCTCCTGTCCCCTGCTCATCCTGCACGCTGAGGACGACCCGGTGGTGCCCTTCCAGCTTGGCAGAAAGCTCTATAGCATCGCCGCACCAGCTCGAAGCTTCCGAGATTTCAAAGTTCAGTTTGTGCCCTTTCATTCAGACCTTGGCTACAGGCACAAATACATTTACAAGAGCCCTGAGCTGCCACGGATACTGAGGGAATTCCTGGGGAAGTCGGAGCCTGAGCACCAGCACTGA

Back to List