Details for gene: IFT172


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; cilium assembly : The assembly of a cilium, a specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface. Each cilium is bounded by an extrusion of the cytoplasmic membrane, and contains a regular longitudinal array of microtubules, anchored basally in a centriole. ; ciliary basal body : A membrane-tethered, short cylindrical array of microtubules and associated proteins found at the base of a eukaryotic cilium (also called flagellum) that is similar in structure to a centriole and derives from it. The cilium basal body is the site of assembly and remodelling of the cilium and serves as a nucleation site for axoneme growth. As well as anchoring the cilium, it is thought to provide a selective gateway regulating the entry of ciliary proteins and vesicles by intraflagellar transport. ; ciliary tip : Part of the cilium where the axoneme ends. The ciliary tip has been implicated in ciliary assembly and disassembly, as well as signal transduction. ; intraciliary transport particle B : The larger subcomplex of the intraciliary transport particle; characterized complexes have molecular weights around 550 kDa. ; axoneme : The bundle of microtubules and associated proteins that forms the core of cilia (also called flagella) in eukaryotic cells and is responsible for their movements. ; extracellular vesicle : Any vesicle that is part of the extracellular region. ; intraciliary transport : The bidirectional movement of large protein complexes along microtubules within a cilium, mediated by motor proteins. ; neural tube formation : The formation of a tube from the flat layer of ectodermal cells known as the neural plate. This will give rise to the central nervous system. ; neural tube closure : The last step in the formation of the neural tube, where the paired neural folds are brought together and fuse at the dorsal midline. ; heart looping : The tube morphogenesis process in which the primitive heart tube loops asymmetrically. This looping brings the primitive heart chambers into alignment preceding their future integration. Heart looping begins with dextral-looping and ends when the main regional divisions of the mature heart and primordium of the great arterial trunks become established preceeding septation. ; Notch signaling pathway : A series of molecular signals initiated by the binding of an extracellular ligand to the receptor Notch on the surface of a target cell, and ending with regulation of a downstream cellular process, e.g. transcription. ; smoothened signaling pathway : A series of molecular signals generated as a consequence of activation of the transmembrane protein Smoothened. ; determination of left/right symmetry : The establishment of an organism's body plan or part of an organism with respect to the left and right halves. The pattern can either be symmetric, such that the halves are mirror images, or asymmetric where the pattern deviates from this symmetry. ; brain development : The process whose specific outcome is the progression of the brain over time, from its formation to the mature structure. Brain development begins with patterning events in the neural tube and ends with the mature structure that is the center of thought and emotion. The brain is responsible for the coordination and control of bodily activities and the interpretation of information from the senses (sight, hearing, smell, etc.). ; heart development : The process whose specific outcome is the progression of the heart over time, from its formation to the mature structure. The heart is a hollow, muscular organ, which, by contracting rhythmically, keeps up the circulation of the blood. ; epidermis development : The process whose specific outcome is the progression of the epidermis over time, from its formation to the mature structure. The epidermis is the outer epithelial layer of an animal, it may be a single layer that produces an extracellular material (e.g. the cuticle of arthropods) or a complex stratified squamous epithelium, as in the case of many vertebrate species. ; regulation of smoothened signaling pathway : Any process that modulates the frequency, rate or extent of smoothened signaling. ; dorsal/ventral pattern formation : The regionalization process in which the areas along the dorsal/ventral axis are established that will lead to differences in cell differentiation. The dorsal/ventral axis is defined by a line that runs orthogonal to both the anterior/posterior and left/right axes. The dorsal end is defined by the upper or back side of an organism. The ventral end is defined by the lower or front side of an organism. ; protein processing : Any protein maturation process achieved by the cleavage of a peptide bond or bonds within a protein. Protein maturation is the process leading to the attainment of the full functional capacity of a protein. ; spinal cord motor neuron differentiation : The process in which neuroepithelial cells in the ventral neural tube acquire specialized structural and/or functional features of motor neurons. Motor neurons innervate an effector (muscle or glandular) tissue and are responsible for transmission of motor impulses from the brain to the periphery. Differentiation includes the processes involved in commitment of a cell to a specific fate. ; neural tube development : The process whose specific outcome is the progression of the neural tube over time, from its formation to the mature structure. The mature structure of the neural tube exists when the tube has been segmented into the forebrain, midbrain, hindbrain and spinal cord regions. In addition neural crest has budded away from the epithelium. ; cytoplasmic microtubule organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of structures formed of microtubules and associated proteins in the cytoplasm of a cell. ; negative regulation of smoothened signaling pathway : Any process that stops, prevents, or reduces the frequency, rate or extent of smoothened signaling. ; positive regulation of smoothened signaling pathway : Any process that activates or increases the frequency, rate or extent of smoothened signaling. ; embryonic camera-type eye morphogenesis : The process in which the anatomical structures of the eye are generated and organized during embryonic development. ; negative regulation of epithelial cell proliferation : Any process that stops, prevents or reduces the rate or extent of epithelial cell proliferation. ; roof of mouth development : The biological process whose specific outcome is the progression of the roof of the mouth from an initial condition to its mature state. This process begins with the formation of the structure and ends with the mature structure. The roof of the mouth is the partition that separates the nasal and oral cavities. ; limb development : The process whose specific outcome is the progression of a limb over time, from its formation to the mature structure. A limb is an appendage of an animal used for locomotion or grasping. Examples include legs, arms or some types of fin. ; bone development : The process whose specific outcome is the progression of bone over time, from its formation to the mature structure. Bone is the hard skeletal connective tissue consisting of both mineral and cellular components. ; hindgut development : The process whose specific outcome is the progression of the hindgut over time, from its formation to the mature structure. The hindgut is part of the alimentary canal that lies posterior to the midgut. ; left/right axis specification : The establishment, maintenance and elaboration of the left/right axis. The left/right axis is defined by a line that runs orthogonal to both the anterior/posterior and dorsal/ventral axes. Each side is defined from the viewpoint of the organism rather of the observer (as per anatomical axes). ; non-motile cilium assembly : The aggregation, arrangement and bonding together of a set of components to form a non-motile cilium. ; sperm midpiece : The highly organized segment of the sperm flagellum which begins at the connecting piece and is characterized by the presence of 9 outer dense fibers (ODFs) that lie outside each of the 9 outer axonemal microtubule doublets and by a sheath of mitochondria that encloses the ODFs and the axoneme; the midpiece terminates about one-fourth of the way down the sperm flagellum at the annulus, which marks the beginning of the principal piece. ; sperm principal piece : The segment of the sperm flagellum where the mitochondrial sheath ends, and the outer dense fibers (ODFs) associated with outer axonemal doublets 3 and 8 are replaced by the 2 longitudinal columns of the fibrous sheath (FS) which run the length of the principal piece and are stabilized by circumferential ribs. The principal piece makes up ~2/3 of the length of the sperm flagellum and is defined by the presence of the FS and of only 7 (rather than 9) ODFs which taper and then terminate near the distal end of the principal piece. ; sperm cytoplasmic droplet : A small amount of cytoplasm surrounded by a cell membrane that is generally retained in spermatozoa after spermiogenesis, when the majority of the cytoplasm is phagocytosed by Sertoli cells to produce what are called residual bodies. Initially, the droplet is located at the neck just behind the head of an elongated spermatid. During epididymal transit, the cytoplasmic droplet migrates caudally to the annulus at the end of the midpiece; the exact position and time varies by species. The cytoplasmic droplet consists of lipids, lipoproteins, RNAs, a variety of hydrolytic enzymes, receptors, ion channels, and Golgi-derived vesicles. The droplet may be involved in regulatory volume loss (RVD) at ejaculation, and in most species, though not in humans, the cytoplasmic droplet is lost at ejaculation. Note that the cytoplasmic droplet is distinct from 'excessive residual cytoplasm' that sometimes remains in epididymal spermatozoa, particularly when spermiogenesis has been disrupted. ; membrane-bounded organelle : Organized structure of distinctive morphology and function, bounded by a single or double lipid bilayer membrane. Includes the nucleus, mitochondria, plastids, vacuoles, and vesicles. Excludes the plasma membrane. ;


Symbol
IFT172
Name
intraflagellar transport 172
Entrez ID
26160
Ensembl ID
ENSG00000138002    (more details)
KEGG ID
hsa:26160    (more details)
OMIM ID
607386
Uniprot ID
Q9UG01  
GO ID
hsa:26160    (more details)
Chromosome
10
Strand
-1
Start
84194537
End
84219621
miRNA Interactions
hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-424-5p (RPM: 9.04) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-497-5p (RPM: 49.4968) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-miR-200c-3p (RPM: 348.3196) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-152-3p (RPM: 242.0024) / hsa-miR-193b-3p (RPM: 184.968) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-3194-5p (RPM: 0.013) / hsa-miR-664a-5p (RPM: 11.0862) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Intraflagellar transport / Hedgehog 'off' state /
Sequence
ATGCACTTGAAGCACCTGAGGACCCTGCTGAGCCCTCAGGATGGAGCTGCAAAGGTGACCTGCATGGCTTGGTCCCAGAACAATGCCAAATTTGCTGTCTGCACAGTGGACCGAGTGGTCTTGCTGTATGATGAACATGGAGAACGGAGAGATAAATTCTCCACCAAACCAGCTGACATGAAGTATGGCAGGAAGAGCTATATGGTGAAGGGCATGGCTTTTTCTCCTGATTCCACTAAAATTGCCATAGGACAGACTGACAACATCATCTATGTCTACAAGATTGGAGAAGATTGGGGTGACAAGAAAGTCATCTGCAACAAGTTCATCCAGACGAGTGCTGTCACTTGTCTGCAATGGCCGGCAGAATACATCATTGTCTTTGGACTGGCTGAAGGGAAGGTTCGTTTAGCAAACACCAAAACTAATAAATCATCTACCATCTATGGGACAGAGTCTTACGTGGTGTCCCTGACAACAAATTGCTCTGGGAAAGGAATTCTCTCTGGTCATGCAGATGGTACCATCGTTAGGTATTTCTTTGATGATGAAGGCTCTGGAGAGTCACAGGGGAAGTTGGTTAACCACCCGTGTCCACCCTATGCCTTGGCATGGGCAACCAATAGCATCGTGGCTGCAGGCTGTGATCGGAAAATTGTAGCCTATGGAAAAGAAGGTCACATGCTACAAACTTTTGATTATAGCCGTGACCCTCAGGAGCGGGAGTTCACCACAGCTGTATCAAGTCCTGGGGGCCAGTCTGTTGTGCTAGGAAGTTATGACAGGCTTCGGGTGTTCAACTGGATCCCTCGAAGAAGCATCTGGGAAGAGGCAAAGCCCAAGGAGATTACCAATTTATACACCATCACTGCCTTGGCCTGGAAGCGGGATGGCTCACGGCTCTGTGTGGGCACACTATGTGGTGGGGTGGAACAGTTTGACTGCTGCCTCCGAAGGAGTATTTACAAGAACAAGTTTGAGTTGACGTATGTGGGACCTAGCCAGGTGATTGTGAAGAACCTGTCATCAGGAACCCGAGTGGTGCTCAAGTCACACTATGGCTATGAGGTGGAAGAGGTGAAAATCCTAGGAAAGGAACGTTACTTGGTGGCTCACACATCAGAAACACTGCTGCTGGGGGACCTGAACACTAATCGGCTTAGTGAGATAGCCTGGCAAGGATCTGGTGGCAATGAGAAGTATTTCTTTGAAAATGAGAATGTATGCATGATCTTCAATGCCGGAGAGCTAACCCTGGTGGAATATGGGAATAATGACACCCTGGGTTCTGTACGCACTGAATTCATGAACCCCCACCTCATCAGTGTTCGTATTAATGAGAGGTGTCAGCGAGGAACAGAAGATAATAAGAAATTGGCTTATCTTATTGATATTAAGACTATTGCTATAGTGGATCTGATTGGTGGCTACAACATTGGCACCGTCAGCCATGAGAGCCGTGTGGATTGGCTGGAACTTAATGAGACTGGACACAAGCTCCTCTTCAGGGACCGGAAACTTCGTTTGCATCTGTATGATATTGAAAGCTGCTCTAAGACAATGATCCTCAACTTCTGCTCCTATATGCAGTGGGTCCCAGGAAGTGACGTGCTGGTAGCTCAGAACCGAAACAGTCTGTGTGTATGGTACAACATTGAGGCACCTGAGAGAGTCACCATGTTCACTATTAGGGGTGATGTTATAGGTCTGGAGCGGGGCGGGGGAAAGACCGAGGTGATGGTGATGGAAGGTGTGACTACTGTTGCCTACACATTGGATGAGGGCCTCATCGAGTTTGGAACAGCCATTGATGATGGCAACTACATCCGGGCAACAGCCTTCTTAGAGACTCTGGAAATGACCCCAGAAACAGAGGCAATGTGGAAAACCTTGAGTAAACTGGCACTAGAGGCAAGGCAACTACACATTGCGGAGAGGTGCTTTTCTGCTTTGGGCCAAGTAGCAAAAGCTCGATTCCTGCATGAGACCAATGAGATTGCAGATCAAGTATCCCGGGAATATGGCGGAGAAGGAACAGACTTTTATCAGGTCCGAGCACGTCTAGCCATGCTGGAAAAGAACTACAAACTGGCTGAAATGATCTTTTTGGAACAGAATGCTGTGGAGGAGGCCATGGGCATGTACCAGGAGCTACACCGTTGGGATGAGTGTATCGCTGTGGCTGAAGCCAAGGGGCACCCAGCCCTGGAGAAGCTACGTCGTAGTTACTACCAGTGGCTGATGGACACACAGCAAGAGGAGCGAGCAGGTGAACTACAGGAGAGCCAAGGGGATGGGCTAGCAGCCATCAGCCTCTACCTCAAAGCTGGGCTCCCTGCCAAAGCTGCTCGGCTGGTGCTGACCCGAGAGGAACTGCTAGCCAACACAGAGCTGGTAGAACACATCACTGCAGCCCTTATCAAGGGGGAACTCTACGAAAGGGCAGGTGATCTCTTTGAGAAGATTCACAATCCACAGAAGGCCCTGGAGTGCTACCGTAAAGGCAACGCATTCATGAAAGCGGTAGAGCTGGCTCGATTGGCCTTCCCAGTGGAGGTGGTGAAACTAGAGGAGGCATGGGGGGACCACCTGGTGCAGCAGAAGCAGCTTGATGCAGCCATTAATCACTACATCGAAGCCAGGTGCTCCATTAAGGCAATTGAGGCCGCCCTGGGTGCCCGCCAGTGGAAGAAGGCAATTTATATATTAGATCTACAGGACCGGAACACTGCATCCAAATACTATCCTCTCGTGGCCCAACACTATGCATCCCTGCAGGAGTATGAGATTGCTGAGGAGCTCTATACTAAGGGAGATCGGACAAAAGATGCCATAGACATGTACACCCAGGCTGGTCGTTGGGAACAAGCCCACAAGCTGGCGATGAAATGCATGAGACCAGAAGATGTGTCAGTGCTATACATCACTCAGGCCCAGGAAATGGAGAAGCAGGGCAAGTACCGTGAGGCTGAAAGGCTATATGTGACAGTACAAGAGCCTGATCTTGCCATCACCATGTACAAAAAGCACAAGTTGTATGATGACATGATCCGCCTGGTAGGGAAGCACCATCCAGATCTCCTCAGTGATACACACCTACATCTGGGCAAGGAGCTGGAGGCTGAAGGCCGACTACAGGAGGCTGAGTACCACTACCTCGAGGCCCAGGAATGGAAGGCAACAGTGAACATGTACCGGGCCAGTGGGCTTTGGGAAGAGGCCTACAGGGTGGCCAGAACTCAAGGAGGGGCTAATGCCCACAAACACGTGGCCTATCTGTGGGCAAAGAGCCTGGGAGGAGAGGCTGCAGTTAGACTGCTTAATAAGCTGGGACTCCTGGAAGCTGCTGTTGACCACGCTGCAGACAATTGCTCCTTTGAATTTGCGTTTGAACTCTCTCGGCTGGCCCTCAAGCACAAAACCCCCGAGGTTCATCTCAAATATGCTATGTTCCTGGAGGATGAGGGTAAATTCGAAGAGGCTGAAGCTGAATTCATCAGAGCTGGTAAACCCAAGGAGGCAGTCCTCATGTTTGTCCATAACCAGGATTGGGAGGCAGCTCAGCGTGTGGCTGAGGCTCACGACCCTGACAGTGTCGCCGAGGTGCTTGTGGGACAGGCCCGGGGGGCCTTGGAGGAGAAGGACTTTCAGAAAGCAGAAGGGCTGCTGCTCCGGGCCCAGAGACCAGGCCTGGCCCTCAATTATTATAAGGAGGCTGGATTATGGAGTGACGCTCTGCGCATCTGCAAGGACTATGTGCCCAGCCAGCTGGAGGCTCTGCAGGAAGAATATGAGCGGGAAGCTACTAAGAAGGGGGCCAGGGGTGTGGAGGGATTTGTGGAACAAGCTCGACACTGGGAGCAGGCTGGAGAGTACAGCCGTGCCGTGGACTGCTACCTCAAAGTGCGAGACTCTGGAAACAGCGGCCTGGCGGAGAAGTGCTGGATGAAGGCAGCTGAACTCTCCATCAAGTTTCTGCCTCCCCAACGTAATATGGAAGTCGTTCTGGCTGTAGGACCCCAGCTGATTGGAATTGGAAAGCACAGTGCAGCTGCAGAGCTCTATCTGAATCTGGACCTTGTCAAGGAAGCAATCGATGCTTTCATCGAGGGTGAGGAGTGGAACAAGGCGAAGCGTGTAGCTAAGGAGTTAGATCCCAGGTATGAAGACTATGTGGACCAGCATTATAAAGAGTTCCTCAAGAATCAGGGCAAAGTGGACTCGCTGGTGGGTGTGGATGTGATAGCTGCTTTGGACCTGTATGTGGAGCAGGGCCAGTGGGACAAGTGCATTGAAACAGCTACCAAGCAGAACTACAAGATTCTGCACAAGTATGTGGCTTTGTATGCAACTCACTTGATCCGGGAGGGTAGCTCTGCCCAGGCATTGGCCCTGTATGTACAGCACGGAGCCCCTGCTAACCCACAGAACTTCAATATCTACAAAAGGATCTTCACTGACATGGTGAGCTCTCCTGGAACCAACTGTGCCGAGGCCTATCATAGCTGGGCTGATCTTCGAGATGTCCTCTTCAACCTGTGTGAAAACCTGGTGAAGTCCAGTGAGGCAAACTCTCCAGCCCATGAGGAGTTCAAGACGATGCTGCTGATCGCTCATTACTATGCCACGCGCTCTGCAGCCCAGAGTGTCAAACAGCTGGAAACCGTGGCTGCCAGGCTTTCTGTTTCACTCTTGCGTCACACCCAGCTACTACCTGTAGACAAAGCCTTCTATGAAGCAGGCATTGCTGCCAAGGCAGTTGGCTGGGATAACATGGCATTCATCTTCCTCAATCGCTTTTTGGACCTGACCGATGCAATCGAGGAAGGGACTCTAGATGGCCTTGACCACTCTGATTTTCAGGATACAGACATTCCCTTTGAGGTGCCACTCCCAGCTAAGCAGCATGTACCGGAGGCTGAGAGAGAAGAGGTTCGAGACTGGGTGCTTACAGTCTCCATGGACCAGCGGCTGGAGCAGGTTCTGCCTCGGGATGAGCGTGGCGCCTACGAGGCCTCCCTAGTGGCAGCGAGCACTGGTGTTCGAGCCCTGCCCTGCCTTATTACAGGATACCCCATTCTGAGGAACAAAATTGAATTTAAGCGGCCAGGGAAGGCTGCTAACAAGGACAACTGGAATAAATTCCTTATGGCCATCAAGACCTCCCACAGCCCAGTGTGCCAGGACGTGCTGAAATTCATCAGTCAGTGGTGTGGAGGGCTCCCCAGCACCAGCTTTTCCTTTCAGTAG

Back to List