Details for gene: SCAPER


zinc ion binding : Interacting selectively and non-covalently with zinc (Zn) ions. ; nucleic acid binding : Interacting selectively and non-covalently with any nucleic acid. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; nuclear speck : A discrete extra-nucleolar subnuclear domain, 20-50 in number, in which splicing factors are seen to be localized by immunofluorescence microscopy. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ;


Symbol
SCAPER
Name
S-phase cyclin A associated protein in the ER
Entrez ID
49855
Ensembl ID
ENSG00000140386    (more details)
KEGG ID
hsa:49855    (more details)
OMIM ID
611611
Uniprot ID
Q9BY12  
GO ID
hsa:49855    (more details)
Chromosome
2
Strand
-1
Start
61824848
End
61854143
miRNA Interactions
hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-5006-3p (RPM: 0.4468) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-139-5p (RPM: 36.887) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-130b-5p (RPM: 60.0122) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-501-5p (RPM: 3.2752) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-4787-5p (RPM: 0.1412) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-2681-5p (RPM: 0.1438) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGATGGCTTCATTCCAGCGCTCCAATAGTCATGACAAAGTAAGGAGAATAGTTGCAGAGGAGGGTCGTACAGCAAGAAACCTAATAGCTTGGAGTGTTCCACTAGAAAGCAAAGATGATGATGGAAAACCTAAATGTCAAACTGGTGGAAAATCTAAGAGGACCATTCAAGGCACTCATAAAACTACTAAACAGAGTACTGCAGTGGACTGTAAAATAACATCGTCTACGACTGGAGATAAACACTTTGATAAAAGTCCCACTAAAACAAGGCACCCTCGGAAAATTGATCTAAGAGCTCGATACTGGGCATTTCTTTTTGATAATCTTCGCCGAGCAGTAGATGAAATCTATGTAACTTGCGAATCAGATCAGAGTGTGGTCGAATGTAAGGAGGTGCTAATGATGCTGGATAACTATGTAAGAGATTTCAAAGCATTGATTGACTGGATTCAGCTTCAGGAAAAGCTAGAGAAGACAGATGCTCAAAGCAGACCAACATCATTGGCATGGGAAGTAAAGAAGATGTCTCCGGGACGCCATGTGATTCCAAGTCCATCAACAGATAGAATAAATGTAACATCAAATGCTCGACGAAGCTTAAATTTTGGAGGTTCAACTGGCACAGTGCCAGCTCCTCGTCTGGCTCCCACAGGTGTCAGTTGGGCTGACAAGGTAAAGGCTCATCATACAGGCTCTACTGCTTCTTCAGAAATAACACCCGCCCAGTCTTGCCCACCAATGACAGTGCAGAAGGCCTCACGCAAAAATGAACGGAAAGATGCTGAAGGATGGGAGACCGTTCAGAGAGGAAGGCCTATTCGTTCTCGATCAACAGCAGTGATGCCAAAAGTTTCATTGGCAACAGAAGCCACAAGATCAAAGGATGACAGTGATAAAGAAAATGTATGTCTTTTACCTGATGAAAGCATACAGAAAGGTCAATTTGTTGGAGATGGAACTTCTAATACTATAGAATCTCATCCCAAAGACTCATTACACTCTTGTGACCATCCTCTTGCCGAAAAAACCCAGTTCACAGTGAGTACATTGGATGATGTGAAGAATTCTGGCAGTATTCGAGACAATTATGTTCGAACTTCTGAAATATCTGCTGTCCACATTGATACAGAGTGTGTTTCAGTTATGCTGCAAGCTGGTACACCTCCTTTACAAGTAAATGAAGAAAAATTTCCAGCAGAGAAAGCAAGGATAGAAAATGAAATGGACCCTTCAGATATTTCAAATTCCATGGCAGAAGTCCTTGCTAAAAAAGAAGAGCTAGCAGATCGTCTAGAAAAGGCCAATGAAGAAGCCATTGCTAGTGCTATTGCTGAAGAAGAACAGTTAACTAGAGAAATTGAAGCTGAAGAAAACAATGATATTAACATTGAAACTGACAACGACAGTGATTTTTCTGCCAGCATGGGCAGTGGGAGTGTTTCTTTCTGTGGTATGTCCATGGACTGGAACGATGTCCTTGCAGATTATGAAGCTCGTGAGTCTTGGCGCCAAAATACATCCTGGGGGGACATTGTAGAAGAAGAACCTGCTAGACCTCCAGGGCATGGAATTCACATGCATGAAAAACTTTCTTCACCCTCTCGTAAAAGAACAATTGCAGAATCTAAGAAGAAACATGAAGAAAAACAAATGAAAGCACAGCAGCTAAGGGAAAAGTTACGCGAAGAGAAAACATTGAAGCTTCAGAAATTGTTAGAAAGGGAGAAGGATGTCCGGAAGTGGAAGGAAGAATTGCTAGATCAACGACGCAGGATGATGGAAGAAAAATTACTTCATGCTGAGTTTAAGCGAGAAGTGCAGTTACAAGCAATTGTGAAAAAAGCACAAGAAGAAGAAGCTAAGGTAAATGAAATTGCCTTTATAAATACCCTTGAAGCCCAGAATAAACGTCATGATGTTTTATCAAAATTGAAGGAATATGAACAGAGGCTTAATGAGCTACAGGAAGAGCGTCAGAGAAGACAGGAAGAAAAGCAAGCACGTGATGAAGCTGTGCAGGAACGCAAGAGAGCTCTAGAGGCAGAGCGGCAGGCCCGTGTAGAAGAATTGTTAATGAAGAGGAAAGAACAAGAAGCCCGAATTGAACAACAGAGGCAAGAAAAGGAAAAAGCCCGTGAGGATGCAGCCCGGGAAAGAGCTAGAGACAGGGAAGAACGATTGGCAGCACTCACAGCTGCTCAACAAGAAGCTATGGAAGAGTTACAGAAAAAAATTCAGCTCAAGCATGATGAAAGTATTCGAAGGCACATGGAACAGATTGAACAAAGAAAAGAAAAAGCTGCTGAGCTAAGCAGTGGGCGACATGCAAATACTGATTATGCCCCCAAACTGACCCCTTATGAAAGAAAGAAGCAGTGTTCTCTCTGCAATGTCCTGATCTCTTCAGAGGTATATCTTTTTAGCCATGTTAAAGGGAGAAAACACCAGCAAGCCGTGAGAGAGAATACCAGCATCCAGGGGCGTGAACTGTCAGATGAAGAAGTGGAGCATCTTTCCTTGAAGAAGTACATTATTGACATTGTGGTTGAAAGTACAGCTCCAGCAGAAGCTTTGAAAGATGGAGAAGAGCGGCAAAAAAATAAAAAAAAAGCCAAAAAGATAAAAGCCCGGATGAACTTCAGGGCTAAGGAATATGAGAGTTTAATGGAAACCAAAAATTCTGGCTCTGATTCACCTTATAAAGCAAAGCTTCAGCGATTAGCCAAAGATCTTCTAAAACAAGTACAAGTTCAAGACAGTGGCTCATGGGCAAACAATAAAGTGTCTGCTTTGGATCGGACCCTAGGAGAGATCACTAGAATACTGGAAAAAGAGAATGTGGCAGATCAGATTGCATTTCAAGCTGCTGGTGGATTAACAGCCCTTGAACACATCCTTCAAGCAGTAGTCCCAGCCACAAATGTGAACACAGTTTTAAGAATTCCTCCTAAGTCTCTCTGCAATGCAATCAATGTTTACAACCTCACCTGCAATAACTGTTCAGAAAACTGCAGTGATGTTCTGTTTAGTAACAAGATTACCTTCTTAATGGACCTCCTGATACACCAGTTGACGGTTTATGTTCCAGATGAAAATAATACTATTTTGGGGAGAAATACAAATAAACAAGTTTTTGAAGGCTTGACAACTGGACTTCTCAAAGTCAGTGCTGTGGTTTTGGGCTGCCTGATTGCCAATCGACCAGATGGAAACTGCCAGCCAGCTACCCCAAAAATACCAACACAGGAAATGAAAAACAAACCCTCACAAGGTGATCCTTTTAACAATCGAGTTCAGGACCTTATCAGCTACGTGGTGAACATGGGTCTGATTGACAAACTGTGTGCCTGCTTCCTCTCGGTGCAAGGCCCAGTGGATGAGAATCCCAAGATGGCCATATTTCTGCAGCATGCCGCAGGACTCTTACATGCAATGTGTACACTGTGCTTTGCTGTCACTGGAAGGTCATACAGCATATTTGACAATAATCGCCAGGATCCCACAGGGCTGACAGCTGCTCTTCAGGCAACCGACCTGGCTGGAGTTCTTCATATGCTCTACTGTGTCCTCTTCCATGGCACCATCTTGGACCCCAGCACTGCCAGTCCCAAGGAGAATTACACTCAAAATACCATCCAAGTGGCCATTCAGAGTTTACGTTTCTTCAACAGCTTTGCAGCTCTTCATCTGCCTGCTTTTCAGTCTATTGTAGGGGCAGAGGGCTTGTCCCTTGCATTCCGGCACATGGCCAGCTCCCTGCTGGGCCACTGCAGCCAAGTCTCCTGTGAAAGCCTCCTTCATGAGGTCATCGTCTGTGTGGGCTACTTCACTGTCAACCACCCAGATAACCAGGTGATCGTGCAGTCCGGCCGCCACCCCACAGTGCTGCAGAAGCTCTGCCAGTTGCCCTTCCAGTATTTCAGTGACCCACGGCTGATCAAAGTACTGTTCCCTTCACTTATCGCTGCTTGTTACAACAACCATCAGAACAAGATCATTCTGGAGCAAGAGATGAGCTGTGTTTTACTGGCCACTTTCATTCAGGATTTGGCACAGACTCCAGGTCAAGCGGAAAACCAGCCTTACCAACCCAAAGGGAAATGCCTTGGTTCCCAAGACTATCTTGAGCTGGCTAACAGATTTCCTCAGCAGGCCTGGGAAGAAGCTCGACAGTTTTTCTTGAAAAAAGAGAAAAAATAA

Back to List