Details for gene: IMPG2


visual perception : The series of events required for an organism to receive a visual stimulus, convert it to a molecular signal, and recognize and characterize the signal. Visual stimuli are detected in the form of photons and are processed to form an image. ; hyaluronic acid binding : Interacting selectively and non-covalently with hyaluronic acid, a polymer composed of repeating dimeric units of glucuronic acid and N-acetyl glucosamine. ; extracellular matrix structural constituent : The action of a molecule that contributes to the structural integrity of the extracellular matrix. ; interphotoreceptor matrix : A specialized extracellularc matrix that surrounds the photoreceptors of the retina and lies between them and the apical surface of the retinal pigment epithelium. The IPM has been implicated in several important activities required for photoreceptor function and maintenance. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; extracellular region : The space external to the outermost structure of a cell. For cells without external protective or external encapsulating structures this refers to space outside of the plasma membrane. This term covers the host cell environment outside an intracellular parasite. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; cell periphery : The part of a cell encompassing the cell cortex, the plasma membrane, and any external encapsulating structures. ; heparin binding : Interacting selectively and non-covalently with heparin, any member of a group of glycosaminoglycans found mainly as an intracellular component of mast cells and which consist predominantly of alternating alpha-(1->4)-linked D-galactose and N-acetyl-D-glucosamine-6-sulfate residues. ; extracellular matrix : A structure lying external to one or more cells, which provides structural support, biochemical or biomechanical cues for cells or tissues. ; protein localization : Any process in which a protein is transported to, or maintained in, a specific location. ; extracellular matrix organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of an extracellular matrix. ; retina morphogenesis in camera-type eye : The process in which the anatomical structure of the retina is generated and organized. ; receptor complex : Any protein complex that undergoes combination with a hormone, neurotransmitter, drug or intracellular messenger to initiate a change in cell function. ;


Symbol
IMPG2
Name
interphotoreceptor matrix proteoglycan 2
Entrez ID
50939
Ensembl ID
ENSG00000081148    (more details)
KEGG ID
hsa:50939    (more details)
OMIM ID
607056
Uniprot ID
F1T0J3  
GO ID
hsa:50939    (more details)
Chromosome
1
Strand
-1
Start
212624474
End
212626775
miRNA Interactions
hsa-miR-1277-5p (RPM: 3.0234) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-26b-5p (RPM: 2999.0356) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-1293 (RPM: 0.4392) / hsa-miR-616-5p (RPM: 3.0294) / hsa-miR-660-3p (RPM: 0.609) / hsa-miR-224-3p (RPM: 2.0554) / hsa-miR-224-5p (RPM: 33.3102) / hsa-miR-5196-3p (RPM: 0.011) / hsa-miR-586 (RPM: 0.0128) / hsa-miR-1976 (RPM: 0.0434) / hsa-miR-34b-5p (RPM: 1.8778) / hsa-miR-4799-5p (RPM: 0.0586) / hsa-miR-190a-3p (RPM: 0.756) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGATTATGTTTCCTCTTTTTGGGAAGATTTCTCTGGGTATTTTGATATTTGTCCTGATAGAAGGAGACTTTCCATCATTAACAGCACAAACCTACTTATCTATAGAGGAGATCCAAGAACCCAAGAGTGCAGTTTCTTTTCTCCTGCCTGAAGAATCAACAGACCTTTCTCTAGCTACCAAAAAGAAACAGCCTCTGGACCGCAGAGAAACTGAAAGACAGTGGTTAATCAGAAGGCGGAGATCTATTCTGTTTCCTAATGGAGTGAAAATCTGCCCAGATGAAAGTGTTGCAGAGGCTGTGGCAAATCATGTGAAGTATTTTAAAGTCCGAGTGTGTCAGGAAGCTGTCTGGGAAGCCTTCAGGACTTTTTGGGATCGACTTCCTGGGCGTGAGGAATATCATTACTGGATGAATTTGTGTGAGGATGGAGTCACAAGTATATTTGAAATGGGCACAAATTTTAGTGAATCTGTGGAACATAGAAGCTTAATCATGAAGAAACTGACTTATGCAAAGGAAACTGTAAGCAGCTCTGAACTGTCTTCTCCAGTTCCTGTTGGTGATACTTCAACATTGGGAGACACTACTCTCAGTGTTCCACATCCAGAGGTGGACGCCTATGAAGGTGCCTCAGAGAGCAGCTTGGAAAGGCCAGAGGAGAGTATTAGCAATGAAATTGAGAATGTGATAGAAGAAGCCACAAAACCAGCAGGTGAACAGATTGCAGAATTCAGTATCCACCTTTTGGGGAAGCAGTACAGGGAAGAACTACAGGATTCCTCCAGCTTTCACCACCAGCACCTTGAAGAAGAATTTATTTCAGAGGTTGAAAATGCATTTACTGGGTTACCAGGCTACAAGGAAATTCGTGTACTTGAATTTAGGTCCCCCAAGGAAAATGACAGTGGCGTAGATGTTTACTATGCAGTTACCTTCAATGGTGAGGCCATCAGCAATACCACCTGGGACCTCATTAGCCTTCACTCCAACAAGGTGGAAAACCATGGCCTTGTGGAACTGGATGATAAACCCACTGTTGTTTATACAATCAGTAACTTCAGAGATTATATTGCTGAGACATTGCAGCAGAATTTTTTGCTGGGGAACTCTTCCTTGAATCCAGATCCTGATTCCCTGCAGCTTATCAATGTGAGAGGAGTTTTGCGTCACCAAACTGAAGATCTAGTTTGGAACACCCAAAGTTCAAGTCTTCAGGCAACGCCGTCATCTATTCTGGATAATACCTTTCAAGCTGCATGGCCCTCAGCAGATGAATCCATCACCAGCAGTATTCCACCACTTGATTTCAGCTCTGGTCCTCCCTCAGCCACTGGCAGGGAACTCTGGTCAGAAAGTCCTTTGGGTGATTTAGTGTCTACACACAAATTAGCCTTTCCCTCGAAGATGGGCCTCAGCTCTTCCCCAGAGGTTTTAGAGGTTAGCAGCTTGACTCTTCATTCTGTCACCCCGGCAGTGCTTCAGACTGGCTTGCCTGTGGCTTCTGAGGAAAGGACTTCTGGATCTCACTTGGTAGAAGATGGATTAGCCAATGTTGAAGAGTCAGAAGATTTTCTTTCTATTGATTCATTGCCTTCAAGTTCATTCACTCAACCTGTGCCAAAAGAAACAATACCATCCATGGAAGACTCTGATGTGTCCTTAACATCTTCACCATATCTGACCTCTTCTATACCTTTTGGCTTGGACTCCTTGACCTCCAAAGTCAAAGACCAATTAAAAGTGAGCCCTTTCCTGCCAGATGCATCCATGGAAAAAGAGTTAATATTTGACGGTGGTTTAGGTTCAGGGTCTGGGCAAAAGGTAGATCTGATTACTTGGCCATGGAGTGAGACTTCATCAGAGAAGAGCGCTGAACCACTGTCCAAGCCGTGGCTTGAAGATGATGATTCACTTTTGCCAGCTGAGATTGAAGACAAGAAACTAGTTTTAGTTGACAAAATGGATTCCACAGACCAAATTAGTAAGCACTCAAAATATGAACATGATGACAGATCCACACACTTTCCAGAGGAAGAGCCTCTTAGTGGGCCTGCTGTGCCCATCTTCGCAGATACTGCAGCTGAATCTGCGTCTCTAACCCTCCCCAAGCACATATCAGAAGTACCTGGTGTTGATGATTACTCAGTTACCAAAGCACCTCTTATACTGACATCTGTAGCAATCTCTGCCTCTACTGATAAATCAGATCAGGCAGATGCCATCCTAAGGGAGGATATGGAACAAATTACTGAGTCATCCAACTATGAATGGTTTGACAGTGAGGTTTCAATGGTAAAGCCAGATATGCAAACTTTGTGGACTATATTGCCAGAATCAGAGAGAGTTTGGACAAGAACTTCTTCCCTAGAGAAATTGTCCAGAGACATATTGGCAAGTACACCACAGAGTGCTGACAGGCTCTGGTTATCTGTGACACAGTCTACCAAATTGCCTCCAACCACAATCTCCACCCTGCTAGAGGATGAAGTAATTATGGGTGTACAGGATATTTCGTTAGAACTGGACCGGATAGGCACAGATTACTATCAGCCTGAGCAAGTCCAAGAGCAAAATGGCAAGGTTGGTAGTTATGTGGAAATGTCAACAAGTGTTCACTCCACAGAGATGGTTAGTGTGGCTTGGCCCACAGAAGGAGGAGATGACTTGAGTTATACCCAGACTTCAGGAGCTTTGGTGGTTTTCTTCAGCCTCCGAGTGACTAACATGATGTTTTCAGAAGATCTGTTTAATAAAAACTCCTTGGAGTATAAAGCCCTGGAGCAAAGATTCTTAGAATTGCTGGTTCCCTATCTCCAGTCAAATCTCACGGGGTTCCAGAACTTAGAAATCCTCAACTTCAGAAATGGCAGCATTGTGGTGAACAGTCGAATGAAGTTTGCCAATTCTGTCCCTCCTAACGTCAACAATGCGGTGTACATGATTCTGGAAGACTTTTGTACCACTGCCTACAATACCATGAACTTGGCTATTGATAAATACTCTCTTGATGTGGAATCAGGTGATGAAGCCAACCCTTGCAAGTTTCAGGCCTGTAATGAATTTTCAGAGTGTCTGGTCAACCCCTGGAGTGGAGAAGCAAAGTGCAGATGCTTCCCTGGATACCTGAGTGTGGAAGAACGGCCCTGTCAGAGTCTCTGTGACCTACAGCCTGACTTCTGCTTGAATGATGGAAAGTGTGACATTATGCCTGGGCACGGGGCCATTTGTAGGTGCCGGGTGGGTGAGAACTGGTGGTACCGAGGCAAGCACTGTGAGGAATTTGTGTCTGAGCCCGTGATCATAGGCATCACTATTGCCTCCGTGGTTGGACTTCTTGTCATCTTTTCTGCTATCATCTACTTCTTCATCAGGACTCTCCAAGCACACCATGACAGGAGTGAAAGAGAGAGTCCCTTCAGTGGCTCCAGCAGGCAGCCTGACAGCCTCTCATCTATTGAGAATGCTGTGAAGTACAACCCCGTGTATGAAAGTCACAGGGCTGGATGTGAGAAGTATGAGGGACCCTATCCTCAGCATCCCTTCTACAGCTCTGCTAGCGGAGACGTGATTGGTGGGCTGAGCAGAGAAGAAATCAGACAGATGTATGAGAGCAGTGAGCTTTCCAGAGAGGAAATTCAAGAGAGAATGAGAGTTTTGGAACTGTATGCCAATGATCCTGAGTTTGCAGCTTTTGTGAGAGAGCAACAAGTGGAAGAGGTTTAA

Back to List