Details for gene: AHI1


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; negative regulation of apoptotic process : Any process that stops, prevents, or reduces the frequency, rate or extent of cell death by apoptotic process. ; centriole : A cellular organelle, found close to the nucleus in many eukaryotic cells, consisting of a small cylinder with microtubular walls, 300-500 nm long and 150-250 nm in diameter. It contains nine short, parallel, peripheral microtubular fibrils, each fibril consisting of one complete microtubule fused to two incomplete microtubules. Cells usually have two centrioles, lying at right angles to each other. At division, each pair of centrioles generates another pair and the twin pairs form the pole of the mitotic spindle. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; adherens junction : A cell-cell junction composed of the epithelial cadherin-catenin complex. The epithelial cadherins, or E-cadherins, of each interacting cell extend through the plasma membrane into the extracellular space and bind to each other. The E-cadherins bind to catenins on the cytoplasmic side of the membrane, where the E-cadherin-catenin complex binds to cytoskeletal components and regulatory and signaling molecules. ; cell junction : A cellular component that forms a specialized region of connection between two or more cells, or between a cell and the extracellular matrix, or between two membrane-bound components of a cell, such as flagella. ; cell differentiation : The process in which relatively unspecialized cells, e.g. embryonic or regenerative cells, acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. Differentiation includes the processes involved in commitment of a cell to a specific fate and its subsequent development to the mature state. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; vesicle-mediated transport : A cellular transport process in which transported substances are moved in membrane-bounded vesicles; transported substances are enclosed in the vesicle lumen or located in the vesicle membrane. The process begins with a step that directs a substance to the forming vesicle, and includes vesicle budding and coating. Vesicles are then targeted to, and fuse with, an acceptor membrane. ; positive regulation of transcription by RNA polymerase II : Any process that activates or increases the frequency, rate or extent of transcription from an RNA polymerase II promoter. ; cilium assembly : The assembly of a cilium, a specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface. Each cilium is bounded by an extrusion of the cytoplasmic membrane, and contains a regular longitudinal array of microtubules, anchored basally in a centriole. ; cell projection organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of a prolongation or process extending from a cell, e.g. a flagellum or axon. ; centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; ciliary basal body : A membrane-tethered, short cylindrical array of microtubules and associated proteins found at the base of a eukaryotic cilium (also called flagellum) that is similar in structure to a centriole and derives from it. The cilium basal body is the site of assembly and remodelling of the cilium and serves as a nucleation site for axoneme growth. As well as anchoring the cilium, it is thought to provide a selective gateway regulating the entry of ciliary proteins and vesicles by intraflagellar transport. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; non-motile cilium : A cilium which may have a variable array of axonemal microtubules but does not contain molecular motors. ; retina layer formation : The process in which the vertebrate retina is organized into three laminae: the outer nuclear layer (ONL), which contains photoreceptor nuclei; the inner nuclear layer (INL), which contains amacrine, bipolar and horizontal cells; and the retinal ganglion cell (RGC) layer. Between the inner and outer nuclear layers, the outer plexiform layer (OPL) contains connections between the photoreceptors and bipolar and horizontal cells. The inner plexiform layer (IPL) is positioned between the INL and the ganglion cell layer and contains the dendrites of RGCs and processes of bipolar and amacrine cells. Spanning all layers of the retina are the radially oriented Mueller glia. ; cell-cell junction : A cell junction that forms a connection between two or more cells in a multicellular organism; excludes direct cytoplasmic intercellular bridges, such as ring canals in insects. ; transmembrane receptor protein tyrosine kinase signaling pathway : A series of molecular signals initiated by the binding of an extracellular ligand to a receptor on the surface of the target cell where the receptor possesses tyrosine kinase activity, and ending with regulation of a downstream cellular process, e.g. transcription. ; MKS complex : A protein complex that is located at the ciliary transition zone and consists of several proteins some of which are membrane bound. Acts as an organiser of transition zone inner structure, specifically the Y-shaped links, in conjunction with the NPHP complex. The MKS complex also acts as part of the selective barrier that prevents diffusion of proteins between the ciliary cytoplasm and cellular cytoplasm as well as between the ciliary membrane and plasma membrane. ; heart looping : The tube morphogenesis process in which the primitive heart tube loops asymmetrically. This looping brings the primitive heart chambers into alignment preceding their future integration. Heart looping begins with dextral-looping and ends when the main regional divisions of the mature heart and primordium of the great arterial trunks become established preceeding septation. ; central nervous system development : The process whose specific outcome is the progression of the central nervous system over time, from its formation to the mature structure. The central nervous system is the core nervous system that serves an integrating and coordinating function. In vertebrates it consists of the brain and spinal cord. In those invertebrates with a central nervous system it typically consists of a brain, cerebral ganglia and a nerve cord. ; cellular protein localization : Any process in which a protein is transported to, and/or maintained in, a specific location at the level of a cell. Localization at the cellular level encompasses movement within the cell, from within the cell to the cell surface, or from one location to another at the surface of a cell. ; positive regulation of receptor internalization : Any process that activates or increases the frequency, rate or extent of receptor internalization. ; hindbrain development : The process whose specific outcome is the progression of the hindbrain over time, from its formation to the mature structure. The hindbrain is the posterior of the three primary divisions of the developing chordate brain, or the corresponding part of the adult brain (in vertebrates, includes the cerebellum, pons, and medulla oblongata and controls the autonomic functions and equilibrium). ; regulation of behavior : Any process that modulates the frequency, rate or extent of behavior, the internally coordinated responses (actions or inactions) of whole living organisms (individuals or groups) to internal or external stimuli. ; photoreceptor cell outer segment organization : A process that is carried out at the cellular level and results in the assembly, arrangement of constituent parts, or disassembly of the outer segment of a photoreceptor cell, a sensory cell that reacts to the presence of light. The outer segment of the photoreceptor cell contains the light-absorbing materials. ; otic vesicle development : The process whose specific outcome is the progression of the otic vesicle over time, from its formation to the mature structure. The otic vesicle is a transient embryonic structure formed during development of the vertebrate inner ear. ; specification of axis polarity : The pattern specification process in which the polarity of a body or organ axis is established and maintained. ; morphogenesis of a polarized epithelium : The morphogenetic process in which the anatomical structures of a polarized epithelium are generated and organized. A polarized epithelium is an epithelium where the epithelial sheet is oriented with respect to the planar axis. ; positive regulation of polarized epithelial cell differentiation : Any process that activates or increases the rate or extent of polarized epithelial cell differentiation. ; cloaca development : The process whose specific outcome is the progression of the cloaca over time, from it's formation to the mature structure. The cloaca is the common chamber into which intestinal, genital and urinary canals open in vertebrates. ; pronephric nephron tubule morphogenesis : The process in which the anatomical structures of a pronephric nephron tubule are generated and organized from an epithelium. A pronephric nephron tubule is an epithelial tube that is part of the pronephric nephron. ; pronephric duct morphogenesis : The process in which the anatomical structures of the pronephric duct are generated and organized. The pronephric duct collects the filtrate from the pronephric tubules and opens to the exterior of the kidney. ; Kupffer's vesicle development : The progression of the Kupffer's vesicle over time from its initial formation until its mature state. The Kupffer's vesicle is a small but distinctive epithelial sac containing fluid, located midventrally posterior to the yolk cell or its extension, and transiently present during most of the segmentation period. ; left/right axis specification : The establishment, maintenance and elaboration of the left/right axis. The left/right axis is defined by a line that runs orthogonal to both the anterior/posterior and dorsal/ventral axes. Each side is defined from the viewpoint of the organism rather of the observer (as per anatomical axes). ;


Symbol
AHI1
Name
Abelson helper integration site 1
Entrez ID
54806
Ensembl ID
ENSG00000135541    (more details)
KEGG ID
hsa:54806    (more details)
OMIM ID
608629
Uniprot ID
Q8N157  
GO ID
hsa:54806    (more details)
Chromosome
1
Strand
-1
Start
212858275
End
212899363
miRNA Interactions
hsa-miR-30c-5p (RPM: 3890.0396) / hsa-miR-30d-5p (RPM: 9562.1366) / hsa-miR-30a-5p (RPM: 15590.711) / hsa-miR-30e-5p (RPM: 2305.0396) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-455-5p (RPM: 19.0882) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-30b-5p (RPM: 1466.5144) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-377-3p (RPM: 4.0398) / hsa-miR-129-5p (RPM: 135.1492) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-369-3p (RPM: 7.3414) / hsa-miR-9-5p (RPM: 3525.806) / hsa-miR-150-5p (RPM: 64.1654) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-30e-3p (RPM: 538.304) / hsa-miR-30a-3p (RPM: 889.1386) / hsa-miR-30d-3p (RPM: 57.136) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-18b-5p (RPM: 0.3398) / hsa-miR-18a-5p (RPM: 3.6074) / hsa-miR-5690 (RPM: 1.0164) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-27b-5p (RPM: 73.6964) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-4517 (RPM: 0.0368) / hsa-miR-4735-3p (RPM: 0.0052) / hsa-miR-26b-3p (RPM: 23.5016) / hsa-miR-1283 (RPM: 0.0564) / hsa-miR-4438 (RPM: 0.0032) / hsa-miR-195-3p (RPM: 6.2776) / hsa-miR-451a (RPM: 111.8608) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-16-2-3p (RPM: 15.7658) / hsa-miR-4761-5p (RPM: 0.0082) / hsa-miR-3159 (RPM: 0.2288) / hsa-miR-4804-3p (RPM: 0.0472) / hsa-miR-636 (RPM: 1.0174) / hsa-miR-941 (RPM: 399.631) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-331-5p (RPM: 4.2262) / hsa-miR-191-5p (RPM: 12993.8088) / hsa-miR-6778-3p (RPM: 0.0066) / hsa-miR-619-5p (RPM: 1.5814) / hsa-miR-7151-3p (RPM: 0.0092) / hsa-miR-6814-5p (RPM: 0.0202) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Anchoring of the basal body to the plasma membrane /
Sequence
ATGCCTACAGCTGAGAGTGAAGCAAAAGTAAAAACCAAAGTTCGCTTTGAAGAATTGCTTAAGACCCACAGTGATCTAATGCGTGAAAAGAAAAAACTGAAGAAAAAACTTGTCAGGTCTGAAGAAAACATCTCACCTGACACTATTAGAAGCAATCTTCACTATATGAAAGAAACTACAAGTGATGATCCCGACACTATTAGAAGCAATCTTCCCCATATTAAAGAAACTACAAGTGATGATGTAAGTGCTGCTAACACTAACAACCTGAAGAAGAGCACGAGAGTCACTAAAAACAAATTGAGGAACACACAGTTAGCAACTGAAAATCCTAATGGTGATGCTAGTGTAGAGGAAGACAAACAAGGAAAGCCAAATAAAAAGGTGATAAAGACGGTGCCCCAGTTGACTACACAAGACCTGAAACCGGAAACTCCTGAGAATAAGGTTGATTCTACACACCAGAAAACACATACAAAGCCACAGCCAGGCGTTGATCATCAGAAAAGTGAGAAGGCAAATGAGGGAAGAGAAGAGACTGATTTAGAAGAGGATGAAGAATTGATGCAAGCATATCAGTGCCATGTAACTGAAGAAATGGCAAAGGAGATTAAGAGGAAAATAAGAAAGAAACTGAAAGAACAGTTGACTTACTTTCCCTCAGATACTTTATTCCATGATGACAAACTAAGCAGTGAAAAAAGGAAAAAGAAAAAGGAAGTTCCAGTCTTCTCTAAAGCTGAAACAAGTACATTGACCATCTCTGGTGACACAGTTGAAGGTGAACAAAAGAAAGAATCTTCAGTTAGATCAGTTTCTTCAGATTCTCATCAAGATGATGAAATAAGCTCAATGGAACAAAGCACAGAAGACAGCATGCAAGATGATACAAAACCTAAACCAAAAAAAACAAAAAAGAAGACTAAAGCAGTTGCAGATAATAATGAAGATGTTGATGGTGATGGTGTTCATGAAATAACAAGCCGAGATAGCCCGGTTTATCCCAAATGTTTGCTTGATGATGACCTTGTCTTGGGAGTTTACATTCACCGAACTGATAGACTTAAGTCAGATTTTATGATTTCTCACCCAATGGTAAAAATTCATGTGGTTGATGAGCATACTGGTCAATATGTCAAGAAAGATGATAGTGGACGGCCTGTTTCATCTTACTATGAAAAAGAGAATGTGGATTATATTCTTCCTATTATGACCCAGCCATATGATTTTAAACAGTTAAAATCAAGACTTCCAGAGTGGGAAGAACAAATTGTATTTAATGAAAATTTTCCCTATTTGCTTCGAGGCTCTGATGAGAGTCCTAAAGTCATCCTGTTCTTTGAGATTCTTGATTTCTTAAGCGTGGATGAAATTAAGAATAATTCTGAGGTTCAAAACCAAGAATGTGGCTTTCGGAAAATTGCCTGGGCATTTCTTAAGCTTCTGGGAGCCAATGGAAATGCAAACATCAACTCAAAACTTCGCTTGCAGCTATATTACCCACCTACTAAGCCTCGATCCCCATTAAGTGTTGTTGAGGCATTTGAATGGTGGTCAAAATGTCCAAGAAATCATTACCCATCAACACTGTACGTAACTGTAAGAGGACTGAAAGTTCCAGACTGTATAAAGCCATCTTACCGCTCTATGATGGCTCTTCAGGAGGAAAAAGGTAAACCAGTGCATTGTGAACGTCACCATGAGTCAAGCTCAGTAGACACAGAACCTGGATTAGAAGAGTCAAAGGAAGTAATAAAGTGGAAACGACTCCCTGGGCAGGCTTGCCGTATCCCAAACAAACACCTCTTCTCACTAAATGCAGGAGAACGAGGATGTTTTTGTCTTGATTTCTCCCACAATGGAAGAATATTAGCAGCAGCTTGTGCCAGCCGGGATGGATATCCAATTATTTTATATGAAATTCCTTCTGGACGTTTCATGAGAGAATTGTGTGGCCACCTCAATATCATTTATGATCTTTCCTGGTCAAAAGATGATCACTACATCCTTACTTCATCATCTGATGGCACTGCCAGGATATGGAAAAATGAAATAAACAATACAAATACTTTCAGAGTTTTACCTCATCCTTCTTTTGTTTACACGGCTAAATTCCATCCAGCTGTAAGAGAGCTAGTAGTTACAGGATGCTATGATTCCATGATACGGATATGGAAAGTTGAGATGAGAGAAGATTCTGCCATATTGGTCCGACAGTTTGATGTTCACAAAAGTTTTATCAACTCACTTTGTTTTGATACTGAAGGTCATCATATGTATTCAGGAGATTGTACAGGGGTGATTGTTGTTTGGAATACCTATGTCAAGATTAATGATTTGGAACATTCAGTGCACCACTGGACTATAAATAAGGAAATTAAAGAAACTGAGTTTAAGGGAATTCCAATAAGTTATTTGGAGATTCATCCCAATGGAAAACGTTTGTTAATCCATACCAAAGACAGTACTTTGAGAATTATGGATCTCCGGATATTAGTAGCAAGGAAGTTTGTAGGAGCAGCAAATTATCGGGAGAAGATTCATAGTACTTTGACTCCATGTGGGACTTTTCTGTTTGCTGGAAGTGAGGATGGTATAGTGTATGTTTGGAACCCAGAAACAGGAGAACAAGTAGCCATGTATTCTGACTTGCCATTCAAGTCACCCATTCGAGACATTTCTTATCATCCATTTGAAAATATGGTTGCATTCTGTGCATTTGGGCAAAATGAGCCAATTCTTCTGTATATTTACGATTTCCATGTTGCCCAGCAGGAGGCTGAAATGTTCAAACGCTACAATGGAACATTTCCATTACCTGGAATACACCAAAGTCAAGATGCCCTATGTACCTGTCCAAAACTACCCCATCAAGGCTCTTTTCAGATTGATGAATTTGTCCACACTGAAAGTTCTTCAACGAAGATGCAGCTAGTAAAACAGAGGCTTGAAACTGTCACAGAGGTGATACGTTCCTGTGCTGCAAAAGTCAACAAAAATCTCTCATTTACTTCACCACCAGCAGTTTCCTCACAACAGTCTAAGTTAAAGCAGTCAAACATGCTGACCGCTCAAGAGATTCTACATCAGTTTGGTTTCACTCAGACCGGGATTATCAGCATAGAAAGAAAGCCTTGTAACCATCAGGTAGATACAGCACCAACGGTAGTGGCTCTTTATGACTACACAGCGAATCGATCAGATGAACTAACCATCCATCGCGGAGACATTATCCGAGTGTTTTTCAAAGATAATGAAGACTGGTGGTATGGCAGCATAGGAAAGGGACAGGAAGGTTATTTTCCAGCTAATCATGTGGCTAGTGAAACACTGTATCAAGAACTGCCTCCTGAGATAAAGGAGCGATCCCCTCCTTTAAGCCCTGAGGAAAAAACTAAAATAGAAAAATCTCCAGCTCCTCAAAAGCAATCAATCAATAAGAACAAGTCCCAGGACTTCAGACTAGGCTCAGAATCTATGACACATTCTGAAATGAGAAAAGAACAGAGCCATGAGGACCAAGGACACATAATGGATACACGGATGAGGAAGAACAAGCAAGCAGGCAGAAAAGTCACTCTAATAGAGTAA

Back to List