Details for gene: KIZ


centrosome : A structure comprised of a core structure (in most organisms, a pair of centrioles) and peripheral material from which a microtubule-based structure, such as a spindle apparatus, is organized. Centrosomes occur close to the nucleus during interphase in many eukaryotic cells, though in animal cells it changes continually during the cell-division cycle. ; spindle organization : A process that is carried out at the cellular level which results in the assembly, arrangement of constituent parts, or disassembly of the spindle, the array of microtubules and associated molecules that forms between opposite poles of a eukaryotic cell during DNA segregation and serves to move the duplicated chromosomes apart. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; cytoskeleton : Any of the various filamentous elements that form the internal framework of cells, and typically remain after treatment of the cells with mild detergent to remove membrane constituents and soluble components of the cytoplasm. The term embraces intermediate filaments, microfilaments, microtubules, the microtrabecular lattice, and other structures characterized by a polymeric filamentous nature and long-range order within the cell. The various elements of the cytoskeleton not only serve in the maintenance of cellular shape but also have roles in other cellular functions, including cellular movement, cell division, endocytosis, and movement of organelles. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; microtubule organizing center : An intracellular structure that can catalyze gamma-tubulin-dependent microtubule nucleation and that can anchor microtubules by interacting with their minus ends, plus ends or sides. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; protein kinase binding : Interacting selectively and non-covalently with a protein kinase, any enzyme that catalyzes the transfer of a phosphate group, usually from ATP, to a protein substrate. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ;


Symbol
KIZ
Name
kizuna centrosomal protein
Entrez ID
55857
Ensembl ID
ENSG00000088970    (more details)
KEGG ID
hsa:55857    (more details)
OMIM ID
615757
Uniprot ID
Q2M2Z5  
GO ID
hsa:55857    (more details)
Chromosome
2
Strand
1
Start
27444377
End
27489805
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-199b-5p (RPM: 234.7942) / hsa-miR-429 (RPM: 100.5032) / hsa-miR-128-3p (RPM: 329.321) / hsa-miR-199a-5p (RPM: 174.3046) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-378c (RPM: 29.1044) / hsa-miR-378a-3p (RPM: 1540.7796) / hsa-miR-23b-3p (RPM: 2125.0486) / hsa-miR-23a-3p (RPM: 613.2568) / hsa-miR-378d (RPM: 8.7748) / hsa-miR-221-5p (RPM: 32.1456) / hsa-miR-422a (RPM: 0.3564) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-550a-3-5p (RPM: 3.3892) / hsa-miR-378i (RPM: 9.2716) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGAGCCGGACCCTCGCATCGGCCGTGCCCCTGTCGAGTCCCGACTACTACGAGAGGCTGGGCCAACTCCAGCACGGGCTGCGGGACAGTGAAAAGAAGAGATTGGACCTGGAAAAGAAACTTTATGAATATAATCAGTCTGATACATGCAGAGTTAAGCTGAAATATGTAAAACTAAAGAATTATCTGAAGGAAATATGTGAATCTGAAAAGAAGGCTCATACTCGAAACCAAGAATATTTAAAGCGATTTGAGCGTGTCCAAGCTCATGTTGTACACTTCACCACAAATACAGAGAAGCTTCAAAAACTGAAGCTCGAATATGAGACTCAAATTAAGAAGATGCTATGCTCAAAAGATAGCCTGGGACTAAAAGAGGAACTGACAGATGAAGACAGAGAAAAGGTTGCAGTGCACGAGGGGATTAACTCAGGAACAGCCATGTCAAGAGGATTGTATCAACCAGCAACAATCTTTATGGGCCGCCAAATGTCAGCCATCTTAAGCATGAGAGATTTCAGTACAGAGCACAAATCTCCCCAGCCCACAAAGAACTTTTCAATTCCTGACCCACATTCACACCGACAGACAGCCCAGAGCAGTAATGTGACAGACAGCTGTGTAGTACAAACTAGTAATGACACACAGTGCTTAAATAAGTCTGACAACATAGATGGAAAGGCATCTCTTCAGATTGGTGAGAAAATGCCAGTCACAGCCAGTGTATTGTCTGAGGAGGAACAAACTCATTGCTTGGAGATAGGAAGTAACACACGTCATGGCAAGAGTAATTTATCTGAAGGCAAAAAGTCTGCTGAACTCAATTCCCCGTTACGGGAAAGATTAAGTCCAGAGAACAGAACCACTGATTTAAAGTGTGACAGTTCCAGCGGATCAGAGGGAGAAATACTGACACGGGAACATATTGAAGTTGAGGAAAAAAGAGCCAGCCCGCCAGTCTCTCCGATACCAGTTTCAGAATACTGTGAATCTGAAAATAAGTGGTCTCAAGAGAAGCATTCTCCTTGGGAAGGTGTTTCAGATCATCTTGCTCACAGGGAACCAAAGTCACAAAAGCCCTTCAGAAAAATGCAGGAAGAGGAGGAGGAAAGTTGGAGCACCAGCAGTGACCTTACCATTTCAATAAGTGAAGATGATCTGATTTTAGAGAGCCCAGAACCACAGCCAAATCCAGGTGGCAAGATGGAGGGAGAAGATGGAATAGAGGCCTTAAAATTAATCCATGCTGAGCAAGAAAGAGTTGCCCTATCCACTGAAAAAAATTGTATTTTGCAAACCCTAAGCTCTCCTGATTCAGAAAAGGAATCCTCCACTAACGCACCAACAAGAGAACCTGGACAAACACCAGACTCAGACGTACCGAGGGCACAGGTGGGTCAGCATGTTGCCACCTTGAAAGAACATGATAATTCTGTCAAAGAAGAGGCAACAGCATTATTGAGAAAAGCCCTTACAGAAGAGTGTGGCCGTAGGTCAGCTATTCACAGTAGTGAATCATCTTGCAGCTTGCCATCTATTCTGAATGACAATAGTGGAATAAAGGAAGCCAAACCTGCTGTATGGCTCAACAGTGTTCCTACAAGGGAACAAGAAGTTTCAAGTGGCTGTGGAGACAAGAGCAAGAAAGAAAATGTGGCTGCAGATATCCCAATCACAGAAACAGAAGCCTATCAGTTGCTGAAGAAGGCCACCCTTCAGGATAATACAAATCAAACTGAAAACAGGTTTCAAAAGACAGATGCTTCTGTGTCACACTTGTCAGGTTTGAATATTGGCAGCGGTGCATTCGAGACAAAGACAGCTAACAAAATTGCTTCGGAAGCTAGTTTTTCATCTAGTGAAGGAAGTCCTTTGTCAAGGCATGAAAACAAAAAGAAACCCGTGATCAATTTAAAATCTAATGCCCTCTGGGATGAGTCTGATGACAGTAACTCAGAAATTGAGGCTGCTTTACGCCCCAGAAACCATAACACCGATGATTCTGATGATTTTTATGACTAA

Back to List