Details for gene: KLHL7


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; protein ubiquitination : The process in which one or more ubiquitin groups are added to a protein. ; Cul3-RING ubiquitin ligase complex : A ubiquitin ligase complex in which a cullin from the Cul3 subfamily and a RING domain protein form the catalytic core; substrate specificity is conferred by a BTB-domain-containing protein. ; nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; cytoplasm : All of the contents of a cell excluding the plasma membrane and nucleus, but including other subcellular structures. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; protein homodimerization activity : Interacting selectively and non-covalently with an identical protein to form a homodimer. ; perinuclear region of cytoplasm : Cytoplasm situated near, or occurring around, the nucleus. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; nucleolus : A small, dense body one or more of which are present in the nucleus of eukaryotic cells. It is rich in RNA and protein, is not bounded by a limiting membrane, and is not seen during mitosis. Its prime function is the transcription of the nucleolar DNA into 45S ribosomal-precursor RNA, the processing of this RNA into 5.8S, 18S, and 28S components of ribosomal RNA, and the association of these components with 5S RNA and proteins synthesized outside the nucleolus. This association results in the formation of ribonucleoprotein precursors; these pass into the cytoplasm and mature into the 40S and 60S subunits of the ribosome. ;


Symbol
KLHL7
Name
kelch like family member 7
Entrez ID
55975
Ensembl ID
ENSG00000122550    (more details)
KEGG ID
hsa:55975    (more details)
OMIM ID
611119
Uniprot ID
A8K364  
GO ID
hsa:55975    (more details)
Chromosome
3
Strand
1
Start
101222546
End
101320575
miRNA Interactions
hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-34a-5p (RPM: 81.3502) / hsa-miR-16-5p (RPM: 2473.4704) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-147a (RPM: 0.0014) / hsa-miR-107 (RPM: 234.4574) / hsa-miR-3194-3p (RPM: 0.0228) / hsa-miR-4738-3p (RPM: 0.3144) / hsa-miR-5691 (RPM: 0.0126) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-431-5p (RPM: 2.9008) / hsa-miR-378a-5p (RPM: 22.027) / hsa-miR-150-5p (RPM: 64.1654) / hsa-miR-4430 (RPM: 0.0026) / hsa-miR-1304-3p (RPM: 12.7066) / hsa-miR-3135b (RPM: 0.0038) / hsa-miR-5698 (RPM: 0.003) / hsa-miR-3652 (RPM: 0.0324) / hsa-miR-203b-3p (RPM: 3.2494) / hsa-miR-181b-5p (RPM: 3069.8278) / hsa-miR-4635 (RPM: 0.0156) / hsa-miR-449b-5p (RPM: 1.2108) / hsa-miR-1-3p (RPM: 26.3428) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-940 (RPM: 4.614) / hsa-miR-659-3p (RPM: 0.0056) / hsa-miR-671-5p (RPM: 10.1036) / hsa-miR-218-1-3p (RPM: 0.0242) / hsa-miR-4284 (RPM: 0.1674) / hsa-miR-622 (RPM: 0.0046) / hsa-miR-1306-5p (RPM: 5.6804) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-449c-5p (RPM: 1.8038) / hsa-miR-34b-5p (RPM: 1.8778) / hsa-miR-4680-5p (RPM: 0.061) / hsa-miR-4677-3p (RPM: 7.6106) / hsa-miR-4679 (RPM: 0.1796) / hsa-miR-143-5p (RPM: 18.0714) / hsa-miR-4638-5p (RPM: 0.0318) / hsa-miR-1307-3p (RPM: 130.8454) / hsa-miR-374c-3p (RPM: 0.0156) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-6805-3p (RPM: 0.0046) / hsa-miR-6879-3p (RPM: 0.0316) / hsa-miR-6854-5p (RPM: 0.1492) / hsa-miR-504-3p (RPM: 0.16) / hsa-miR-6890-3p (RPM: 0.0048) / hsa-miR-6773-3p (RPM: 0.0024) / hsa-miR-6814-5p (RPM: 0.0202) / hsa-miR-500b-3p (RPM: 0.3408) / hsa-miR-7705 (RPM: 0.6122) / hsa-miR-6821-3p (RPM: 0.0074) / hsa-miR-6877-3p (RPM: 0.1494) / hsa-miR-6819-3p (RPM: 0.0696) / hsa-miR-6741-3p (RPM: 0.6252) / hsa-miR-6790-3p (RPM: 0.0104) / hsa-miR-7158-3p (RPM: 1.0142) / hsa-miR-215-3p (RPM: 0.0012) / hsa-miR-4707-3p (RPM: 0.9608) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGGCAGCCTCTGGGGTGGAGAAGAGCAGCAAGAAGAAGACCGAGAAGAAACTTGCTGCTCGGGAAGAAGCTAAATTGTTGGCGGGTTTCATGGGCGTCATGAATAACATGCGGAAACAGAAAACGTTGTGTGACGTGATCCTCATGGTCCAGGAAAGAAAGATACCTGCTCATCGTGTTGTTCTTGCTGCAGCCAGTCATTTTTTTAACTTAATGTTCACAACTAACATGCTTGAATCAAAGTCCTTTGAAGTAGAACTCAAAGATGCTGAACCTGATATTATTGAACAACTGGTGGAATTTGCTTATACTGCTAGAATTTCCGTGAATAGCAACAATGTTCAGTCTTTGCTGGATGCAGCAAACCAATATCAGATTGAACCTGTGAAGAAAATGTGTGTTGATTTTTTGAAAGAACAAGTTGATGCTTCAAATTGTCTTGGTATAAGTGTGCTAGCGGAGTGTCTAGATTGTCCTGAATTGAAAGCAACTGCAGATGACTTTATTCATCAGCACTTTACTGAAGTTTACAAAACTGATGAATTTCTTCAACTTGATGTCAAGCGAGTAACACATCTTCTCAACCAGGACACTCTGACTGTGAGAGCAGAGGATCAGGTTTATGATGCTGCAGTCAGGTGGTTGAAATACGATGAACCTAATCGCCAGCCATTTATGGTTGATATCCTTGCTAAAGTCAGGTTTCCTCTTATATCAAAGAATTTCTTAAGTAAAACGGTACAAGCTGAACCACTTATTCAAGACAATCCTGAATGCCTTAAGATGGTGATAAGTGGAATGAGGTACCATCTACTGTCTCCAGAGGACCGAGAAGAACTTGTAGATGGCACAAGACCTAGAAGAAAGAAACATGACTACCGCATAGCCCTATTTGGAGGCTCTCAACCACAGTCTTGTAGATATTTTAACCCAAAGGATTATAGCTGGACAGACATCCGCTGCCCCTTTGAAAAACGAAGAGATGCAGCATGCGTGTTTTGGGACAATGTAGTATACATTTTGGGAGGCTCTCAGCTTTTCCCAATAAAGCGAATGGACTGCTATAATGTAGTGAAGGATAGCTGGTATTCGAAACTGGGTCCTCCGACACCTCGAGACAGCCTTGCTGCATGTGCTGCAGAAGGCAAAATTTATACATCTGGAGGTTCAGAAGTAGGAAACTCAGCTCTGTATTTATTTGAGTGCTATGATACGAGAACTGAAAGCTGGCACACAAAGCCCAGCATGCTGACCCAGCGCTGCAGCCATGGGATGGTGGAAGCCAATGGCCTAATCTATGTTTGTGGTGGAAGTTTAGGAAACAATGTTTCTGGGAGAGTGCTTAATTCCTGTGAAGTTTATGATCCTGCCACAGAAACATGGACTGAGCTGTGTCCAATGATTGAAGCCAGGAAGAATCATGGGCTGGTATTTGTAAAAGACAAGATATTTGCTGTGGGTGGTCAGAATGGTTTAGGTGGTCTGGACAATGTGGAATATTACGATATTAAGTTGAACGAATGGAAGATGGTCTCACCAATGCCATGGAAGGGTGTAACAGTGAAATGTGCAGCAGTTGGCTCTATAGTTTATGTCTTGGCTGGTTTTCAGGGTGTTGGTCGATTAGGACACATTCTCGAATATAATACCGAAACAGACAAATGGGTTGCCAACTCCAAAGTTCGTGCTTTTCCAGTCACAAGTTGTTTAATTTGTGTTGTCGATACTTGTGGAGCAAATGAAGAGACCCTTGAAACATGA

Back to List