Details for gene: KIAA1549


membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; cilium : A specialized eukaryotic organelle that consists of a filiform extrusion of the cell surface and of some cytoplasmic parts. Each cilium is largely bounded by an extrusion of the cytoplasmic (plasma) membrane, and contains a regular longitudinal array of microtubules, anchored to a basal body. ; cell projection : A prolongation or process extending from a cell, e.g. a flagellum or axon. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; photoreceptor connecting cilium : The portion of the photoreceptor cell cilium linking the photoreceptor inner and outer segments. It's considered to be equivalent to the ciliary transition zone. ;


Symbol
KIAA1549
Name
KIAA1549
Entrez ID
57670
Ensembl ID
ENSG00000122778    (more details)
KEGG ID
hsa:57670    (more details)
OMIM ID
613344
Uniprot ID
Q9HCM3  
GO ID
hsa:57670    (more details)
Chromosome
7
Strand
-1
Start
23105758
End
23177914
miRNA Interactions
hsa-miR-29b-3p (RPM: 118.8178) / hsa-miR-141-3p (RPM: 2843.5066) / hsa-miR-29c-3p (RPM: 661.3514) / hsa-miR-29a-3p (RPM: 1246.9046) / hsa-miR-423-5p (RPM: 976.289) / hsa-miR-200a-3p (RPM: 157.5826) / hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-1303 (RPM: 5.3758) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-335-3p (RPM: 837.9252) / hsa-miR-338-3p (RPM: 158.4942) / hsa-miR-92a-3p (RPM: 16961.15) / hsa-miR-129-5p (RPM: 135.1492) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-miR-767-5p (RPM: 20.579) / hsa-let-7b-5p (RPM: 3396.2052) / hsa-miR-4731-5p (RPM: 0.185) / hsa-let-7f-5p (RPM: 17066.6836) / hsa-miR-4705 (RPM: 0.444) / hsa-let-7c-5p (RPM: 4028.6728) / hsa-miR-130a-3p (RPM: 723.372) / hsa-let-7i-5p (RPM: 2025.2084) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-130b-3p (RPM: 68.2014) / hsa-miR-98-5p (RPM: 1660.0964) / hsa-miR-150-5p (RPM: 64.1654) / hsa-let-7e-5p (RPM: 3790.2074) / hsa-let-7g-5p (RPM: 3559.4376) / hsa-miR-128-3p (RPM: 329.321) / hsa-let-7a-5p (RPM: 32160.4734) / hsa-miR-3149 (RPM: 0.0328) / hsa-miR-301b-3p (RPM: 9.609) / hsa-miR-301a-3p (RPM: 142.8494) / hsa-miR-939-5p (RPM: 0.5712) / hsa-miR-1296-5p (RPM: 36.5114) / hsa-miR-21-5p (RPM: 5494.851) / hsa-let-7d-5p (RPM: 1078.3154) / hsa-miR-22-3p (RPM: 26348.475) / hsa-miR-3180-5p (RPM: 0.2226) / hsa-miR-122-5p (RPM: 0.5028) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-4524a-3p (RPM: 0.2608) / hsa-miR-376a-5p (RPM: 4.9822) / hsa-miR-3620-3p (RPM: 0.8762) / hsa-miR-5589-5p (RPM: 0.0034) / hsa-miR-196b-5p (RPM: 0.2478) / hsa-miR-4701-5p (RPM: 0.05) / hsa-miR-769-3p (RPM: 3.6276) / hsa-miR-224-5p (RPM: 33.3102) / hsa-miR-4438 (RPM: 0.0032) / hsa-miR-744-3p (RPM: 3.4814) / hsa-miR-4781-3p (RPM: 1.0594) / hsa-miR-4732-5p (RPM: 0.0008) / hsa-miR-1306-5p (RPM: 5.6804) / hsa-miR-17-3p (RPM: 13.6088) / hsa-miR-4423-5p (RPM: 0.3674) / hsa-miR-196a-5p (RPM: 0.311) / hsa-miR-155-5p (RPM: 106.9134) / hsa-miR-5089-5p (RPM: 0.0026) / hsa-miR-3674 (RPM: 0.0024) / hsa-miR-502-3p (RPM: 26.4154) / hsa-miR-744-5p (RPM: 290.9362) / hsa-miR-501-3p (RPM: 166.2736) / hsa-miR-525-5p (RPM: 0.003) / hsa-miR-520a-5p (RPM: 0.0512) / hsa-miR-1202 (RPM: 0.0012) / hsa-miR-186-3p (RPM: 0.0884) / hsa-miR-125b-1-3p (RPM: 418.646) / hsa-miR-888-3p (RPM: 0.0024) / hsa-miR-4700-3p (RPM: 0.0656) / hsa-miR-500a-3p (RPM: 426.0306) / hsa-miR-218-5p (RPM: 36.775) / hsa-miR-210-3p (RPM: 361.0562) / hsa-miR-483-5p (RPM: 0.9526) / hsa-miR-6784-3p (RPM: 0.6362) / hsa-miR-6862-3p (RPM: 0.0932) / hsa-miR-619-5p (RPM: 1.5814) / hsa-miR-6832-5p (RPM: 0.0478) / hsa-miR-6506-5p (RPM: 0.1086) / hsa-miR-7151-3p (RPM: 0.0092) / hsa-miR-6501-5p (RPM: 0.0094) / hsa-miR-500b-3p (RPM: 0.3408) / hsa-miR-6865-3p (RPM: 0.0874) / hsa-miR-7156-3p (RPM: 0.0008) / hsa-miR-1180-3p (RPM: 231.004) / hsa-miR-6861-3p (RPM: 0.0034) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGCCGGGGGCGCGGCGCCGACGCCGAGGCGCGGCCATGGAGGGGAAGCCCCGCGCCGGGGTCGCGCTGGCCCCGGGGCCGAGCGGCCGACGGCCTTCCGCCCGCTGCGCCCGCCGCCGCCGCCCGGGGCTGCTGCTTCCTGGCCTCTGGCTGCTGCTGCTGGCCCGGCCGGCCTCGTGCGCCCCAGATGAGCTCTCTCCGGAACAGCACAACCTTTCTTTATACTCCATGGAGCTCGTGCTGAAGAAAAGCACTGGGCACAGCGCTGCACAAGTGGCCTTAACAGAAACTGCTCCCGGCTCCCAGCACAGCAGTCCTCTCCATGTCACAGCCCCGCCGTCTGCCACTACTTTTGATACAGCCTTTTTTAACCAAGGAAAACAGACCAAAAGTACAGCAGATCCCAGCATCTTTGTGGCAACTTACGTGTCAGTGACGAGTAAAGAGGTGGCCGTCAATGACGATGAGATGGATAACTTTCTGCCAGATACTCACTGGACCACTCCACGGATGGTTTCTCCAATACAGTATATCACAGTCAGCCCACCAGGGCTGCCCAGGGAAGCATTAGAACCTATGCTCACTCCATCATTACCCATGGTTTCTTTACAAGATGAAGAAGTGACATCGGGCTGGCAGAACACAACGCGACAACCAGCGGCATATGCTGAGTCCGCCAGTCATTTCCACACCTTTCGGTCAGCTTTTCGCACCTCTGAGGGCATCGTTCCAACTCCTGGCAGGAATTTGGTGCTTTATCCTACTGATGCTTACAGTCATTTATCAAGCAGGACTCTGCCAGAGATTGTGGCTTCCCTAACAGAGGGTGTGGAAACCACCCTTTTTTTAAGCTCCCGGTCTTTAATGCCACAGCCGTTAGGCGACGGCATTACTATACCGTTGCCCTCCTTGGGGGAGGTCTCACAGCCTCCAGAGGAGGTTTGGGCCACAAGTGCAGACAGATACACTGATGTGACCACTGTGTTGAGTCAAAGCCTAGAAGAAACCATCTCTCCAAGAACATACCCCACTGTGACTGCATCGCACGCAGCCCTTGCATTCAGCAGGACACATTCTCCATTGCTTTCAACTCCTCTTGCATTTGCGTCCTCTGCTTCACCAACTGATGTTTCATCTAACCCCTTTCTCCCTAGCGACTCCAGCAAAACATCCGAATTGCATAGCAATTCAGCCCTCCCCGGTCCTGTGGACAACACTCATATCCTGAGCCCGGTGTCCTCATTCAGACCATACACTTGGTGTGCGGCCTGCACTGTGCCTTCACCTCAGCAAGTTCTGGCCACGAGCCTCATGGAGAAAGACGTGGGATCAGGGGATGGTGCCGAGACTCTGTGCATGACCGTGCTGGAAGAAAGCAGCATCTCTCTAATGAGTAGCGTCGTAGCAGACTTCTCTGAATTTGAGGAAGATCCTCAAGTATTTAATACGCTTTTCCCCTCCAGACCTATCGTCCCACTTTCTTCTAGATCCATGGAAATCTCAGAGACGAGTGTTGGCATTTCTGCCGAGGTGGATATGAGTAGTGTTACAACCACACAGGTTCCCCCTGCCCACGGCCGCCTCTCTGTGCCGGCGTCACTTGATCCTACTGCTGGCTCCTTGTCTGTTGCTGAAACCCAAGTGACGCCATCCAGCGTGACCACTGCATTTTTCTCGGTCATCACCAGCATTCTCCTTGACTCATCTTTCTCTGTCATAGCAAACAAAAACACACCGTCGCTTGCCGTCAGAGACCCGAGTGTTTTTACGCCTTATAGTCTGGTTCCTTCAGTGGAGTCTTCACTTTTCTCTGACCAAGAACGTTCCAGTTTTTCTGAGCATAAACCCAGAGGTGCTTTGGATTTTGCATCCAGCTTTTTCTCAACACCCCCGCTGGAACTCAGCGGCTCCATCTCTTCGCCTTCGGAAGCACCTGCGTCTCTGTCTCTGATGCCGAGTGACTTGTCCCCCTTCACATCTCAGTCTTTTTCTCCCTTGGTTGAGACATTTACATTGTTTGACTCTAGTGATCTGCAGTCATCTCAGCTGTCTCTTCCCAGTTCCACAAATCTTGAGTTTTCGCAGCTCCAGCCAAGTTCCGAGCTGCCTTTAAACACCATCATGTTGCTACCTAGCCGTTCTGAGGTGTCACCATGGTCAAGCTTCCCTTCTGATTCTCTCGAGTTTGTTGAAGCGTCTACGGTTTCACTGACGGATTCAGAAGCTCATTTTACCTCAGCTTTCATTGAAACTACCTCCTATCTTGAGTCTTCACTCATTTCCCATGAATCCGCAGTCACTGCACTGGTGCCCCCCGGCTCTGAGTCTTTTGACATTTTGACTGCCGGGATTCAAGCAACATCACCATTGACCACTGTCCACACAACGCCCATTTTAACTGAGTCTTCTTTGTTCTCAACTCTGACACCTCCTGACGACCAAATCAGTGCTCTAGACGGTCACGTGTCTGTCCTGGCCTCTTTCTCCAAAGCCATTCCCACTGGTACGGTGTTGATCACTGACGCGTACCTGCCATCAGGATCCTCGTTTGTTTCTGAAGCAACCCCCTTCCCTCTGCCCACAGAGCTGACCGTCGTGGGCCCATCACTCACACCCACAGAGGTGCCACTGAACACCTCCACGGAAGTGAGCACAACCAGCACCGGTGCTGCCACTGGTGGTCCCCTCGACTCCACCCTGATGGGTGACGCCGCAAGTCAGAGCCCCCCAGAGAGTAGTGCTGCTCCTCCCCTGCCATCCCTGCGTCCCGTGACTGCCTTCACTCTCGAAGCAACAGTCGACACACCAACACTGGCTACTGCCAAGCCGCCATATGTTTGTGATATCACAGTCCCCGATGCCTATCTGATCACAACTGTGCTGGCCAGAAGAGCTGTGCAGGAGTACATCATTACAGCAATCAAAGAAGTACTGAGGATTCACTTCAACCGTGCAGTGGAACTGAAGGTTTACGAACTATTTACTGACTTCACTTTTCTGGTAACATCCGGTCCTTTCGTTTACACGGCAATATCCGTCATAAATGTGCTTATAAACAGTAAGCTTGTCCGTGACCAGACTCCTTTAATCCTGTCTGTGAAACCTTCTTTCCTTGTGCCAGAGTCCAGGTTCCAAGTTCAAACAGTACTTCAGTTTGTGCCTCCGAGTGTGGATACTGGCTTCTGCAACTTCACCCAGCGCATTGAGAAAGGCCTAATGACAGCTCTCTTTGAAGTGAGAAAACACCACCAGGGAACGTATAACCTCACGGTGCAGATCTTGAATATCACCATCAGTTCCTCAAGGGTGACTCCTCGGCGGGGCCCGGTGAATATCATCTTTGCGGTTAAAAGCACACAGGGATTTTTGAATGGGTCGGAAGTGAGCGAGCTGCTCAGAAACTTGAGTGTGGTGGAGTTCAGTTTCTATCTGGGATACCCAGTGCTGCAGATCGCAGAGCCCTTCCAGTATCCACAGCTCAACTTATCTCAGTTGCTGAAGTCCTCTTGGGTCAGAACAGTTCTCCTGGGCGTCATGGAGAAGCAACTCCAGAATGAAGTGTTTCAAGCCGAGATGGAACGCAAGCTGGCCCAGCTGCTCAGCGAGGTTTCCACCAGAAGGCGGATGTGGAGAAGGGCCACTGTAGCTGCAGGGAACAGTGTGGTGCAGGTGGTAAATGTGTCGAGGCTGGAGGGAGATGACAATCCGGTACAGCTCATCTACTTTGTGGAGGATCAAGATGGAGAAAGACTCAGTGCAGTCAAGTCTTCGGACCTGATTAACAAAATGGACCTCCAGAGAGCAGCCATCATCTTGGGTTACCGAATTCAAGGTGTCATTGCCCAGCCTGTCGACAGGGTGAAGAGGCCGTCTCCGGAATCCCAGAGCAACAACTTGTGGGTCATTGTTGGCGTGGTCATCCCAGTGCTGGTGGTGATGGTGATTGTTGTCATCCTCTACTGGAAACTATGCCGCACAGACAAGCTAGACTTTCAGCCTGACACTGTGGCCAACATTCAGCAGCGTCAGAAGCTGCAGATCCCTAGTGTGAAGGGCTTCGATTTTGCTAAGCAGCATCTGGGTCAGCACAATAAAGACGACATATTGATTATTCATGAGCCAGCGCCACTGCCAGGACCTCTGAAGGACCACACCACGCCCTCGGAAAATGGAGACGTGCCAAGCCCCAAGTCAAAGATCCCTTCCAAGAATGTTCGTCACAGAGGAAGAGTTTCTCCCTCAGATGCTGACTCTACGGTCAGTGAAGAGTCCAGCGAGAGGGACGCAGGAGATAAGACGCCGGGAGCCGTCAACGATGGCAGGTCCCACAGAGCTCCGCAGAGCGGGCCACCACTGCCCAGTTCGGGAAATGAGCAGCACTCATCAGCCTCCATCTTCGAGCACGTGGACAGGATCTCCCGCCCCCCGGAGGCTAGCCGGCGGGTCCCCAGTAAGATCCAGCTTATCGCCATGCAGCCGATCCCGGCACCTCCCGTCCAGCGCCCCTCCCCAGCCGACCGAGTGGCGGAAAGCAATAAAATCAACAAAGAGATTCAGACCGCGCTGCGGCACAAGTCTGAGATCGAGCACCATCGCAACAAGATCCGCCTGCGCGCCAAGCGCCGCGGGCACTACGAGTTCCCGGTGGTAGACGACCTGTCCTCGGGCGACACTAAGGAGCGACACCGGGTGTACCGCAGGGCACAGATGCAGATCGACAAGATCCTGGACCCCACGGCCAGCGTGCCCTCCGTGTTCATAGAGCCCAGGAAGAGCTCACGGATAAAACGTTCTCCCAAGCCTCGCCGGAAACACCAGGTCAACGGCTGTCCTGCCGACGCTGAGAAGGACCGGCTCATCACCACAGACAGCGATGGCACCTACAGGAGGCCCCCCGGCGTCCACAACTCAGCCTACATCGGATGCCCATCGGATCCTGACCTCCCAGCCGATGTGCAGACACCATCCTCGGTGGAACTGGGGAGGTATCCAGCCCTTCCCTTCCCGGCCTCCCAGTACATCCCACCCCAGCCGTCCATCGAGGAGGCACGCCAGACCATGCACTCCCTCCTGGACGACGCCTTTGCCCTCGTGGCCCCCAGCAGCCAGCCTGCCAGCACCGCAGGTGTAGGCCCCGGAGTCCCACCCGGCCTGCCCGCAAACAGCACCCCTTCCCAGGAAGAGAGGCGAGCCACCCAGTGGGGGTCCTTCTACAGCCCAGCCCAGACGGCCAACAATCCCTGCAGTAGATACGAAGACTATGGAATGACTCCCCCGACGGGTCCATTGCCAAGACCAGGTTTTGGCCCCGGTTTGCTGCAGTCTACAGAGCTGGTGCCCCCTGACCCTCAGCAGCCACAGGCCTCCGCCGAAGCCCCATTTGCTGCCAGAGGGATCTACTCGGAGGAGATGCCGTCGGTGGCCCGGCCTCGGCCTGTCGGGGGTACCACAGGCTCCCAGATCCAGCACCTGACACAGGTGGGGATTGCCAGCAGAATTGGAGCTCAGCCAGTGGAAATCCCGCCAAGCAGAGGCAGCCAGTATGGGGGGCCAGGCTGGCCTTCGTACGGGGAGGACGAAGCGGGGCGAAGAGAGGCCACACACATGCTCGGACATCAAGAGTATTCTTCTTCACCGCTATTTCAGGTGCCAAGGACTTCAGGCAGGGAGCCCTCAGCTCCTTCCGGGAACCTCCCCCACCGGGGACTGCAGGGCCCTGGGCTGGGTTACCCCACCAGCTCCACGGAAGACCTCCAGCCTGGCCACTCCTCGGCCTCTCTCATCAAAGCAATCCGCGAGGAGCTCCTCCGGCTCTCCCAGAAACAGAGCACCGTGCAGAACTTCCACAGCTGA

Back to List