Details for gene: SLC7A14


membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; transmembrane transporter activity : Enables the transfer of a substance, usually a specific substance or a group of related substances, from one side of a membrane to the other. ; transmembrane transport : The process in which a solute is transported across a lipid bilayer, from one side of a membrane to the other. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; intracellular membrane-bounded organelle : Organized structure of distinctive morphology and function, bounded by a single or double lipid bilayer membrane and occurring within the cell. Includes the nucleus, mitochondria, plastids, vacuoles, and vesicles. Excludes the plasma membrane. ; nucleoplasm : That part of the nuclear content other than the chromosomes or the nucleolus. ; cytosol : The part of the cytoplasm that does not contain organelles but which does contain other particulate matter, such as protein complexes. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; lysosomal membrane : The lipid bilayer surrounding the lysosome and separating its contents from the cell cytoplasm. ; amino acid transmembrane transport : The process in which an amino acid is transported across a membrane. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; lysosome : A small lytic vacuole that has cell cycle-independent morphology and is found in most animal cells and that contains a variety of hydrolases, most of which have their maximal activities in the pH range 5-6. The contained enzymes display latency if properly isolated. About 40 different lysosomal hydrolases are known and lysosomes have a great variety of morphologies and functions. ; amino acid transport : The directed movement of amino acids, organic acids containing one or more amino substituents, into, out of or within a cell, or between cells, by means of some agent such as a transporter or pore. ; amino acid transmembrane transporter activity : Enables the transfer of amino acids from one side of a membrane to the other. Amino acids are organic molecules that contain an amino group and a carboxyl group. ;


Symbol
SLC7A14
Name
solute carrier family 7 member 14
Entrez ID
57709
Ensembl ID
ENSG00000013293    (more details)
KEGG ID
hsa:57709    (more details)
OMIM ID
615720
Uniprot ID
Q8TBB6  
GO ID
hsa:57709    (more details)
Chromosome
1
Strand
-1
Start
46188683
End
46220305
miRNA Interactions
hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-26a-5p (RPM: 45169.4864) / hsa-miR-4775 (RPM: 1.173) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-450b-5p (RPM: 4.6184) / hsa-miR-4684-3p (RPM: 0.2602) / hsa-miR-544a (RPM: 0.082) / hsa-miR-5001-3p (RPM: 0.622) / hsa-miR-495-3p (RPM: 8.062) / hsa-miR-5701 (RPM: 25.899) / hsa-miR-129-2-3p (RPM: 79.8688) / hsa-miR-369-3p (RPM: 7.3414) / hsa-miR-4769-3p (RPM: 0.0098) / hsa-miR-365a-3p (RPM: 22.318) / hsa-miR-365b-3p (RPM: 22.318) / hsa-miR-21-3p (RPM: 238.3548) / hsa-miR-4727-5p (RPM: 0.006) / hsa-miR-4695-3p (RPM: 0.0182) / hsa-miR-33a-5p (RPM: 5.9422) / hsa-miR-192-3p (RPM: 0.4144) / hsa-miR-4701-5p (RPM: 0.05) / hsa-miR-1238-3p (RPM: 0.0018) / hsa-miR-224-5p (RPM: 33.3102) / hsa-miR-5589-3p (RPM: 0.055) / hsa-miR-744-3p (RPM: 3.4814) / hsa-miR-106a-3p (RPM: 0.061) / hsa-miR-5585-3p (RPM: 0.2034) / hsa-miR-4797-3p (RPM: 0.2402) / hsa-miR-4424 (RPM: 0.593) / hsa-miR-1976 (RPM: 0.0434) / hsa-miR-433-3p (RPM: 9.0888) / hsa-miR-27a-5p (RPM: 7.3838) / hsa-miR-5011-3p (RPM: 0.0008) / hsa-miR-182-3p (RPM: 20.9678) / hsa-miR-194-3p (RPM: 0.633) / hsa-miR-126-3p (RPM: 494.5936) / hsa-miR-1247-3p (RPM: 20.5724) / hsa-miR-99a-3p (RPM: 26.3048) / hsa-miR-6778-3p (RPM: 0.0066) / hsa-miR-670-3p (RPM: 1.3964) / hsa-miR-6780a-3p (RPM: 0.023) / hsa-miR-6747-3p (RPM: 0.3694) / hsa-miR-6881-3p (RPM: 0.2412) / hsa-miR-6727-3p (RPM: 0.0068) / hsa-miR-6738-3p (RPM: 0.0212) / hsa-miR-6796-3p (RPM: 0.01) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGAGTGGCTTCTTCACCTCGCTGGACCCCCGGCGGGTGCAGTGGGGAGCTGCCTGGTATGCAATGCACTCCAGGATCCTACGCACCAAACCAGTGGAGTCCATGCTAGAGGGAACTGGGACCACCACGGCACATGGAACTAAGCTAGCCCAGGTACTCACCACAGTGGACCTCATCTCTCTTGGCGTTGGCAGCTGTGTGGGCACTGGCATGTATGTGGTCTCTGGCCTGGTGGCCAAGGAAATGGCAGGACCTGGTGTCATTGTGTCCTTCATCATTGCAGCCGTCGCATCCATATTATCAGGCGTCTGCTATGCAGAGTTTGGAGTTCGAGTCCCCAAGACCACAGGATCTGCCTACACCTACAGCTATGTCACTGTTGGGGAATTTGTGGCATTTTTCATTGGCTGGAACCTGATCCTGGAGTACCTGATTGGCACTGCGGCCGGAGCCAGTGCTCTGAGCAGCATGTTTGACTCACTAGCCAACCACACCATCAGCCGCTGGATGGCGGACAGCGTGGGAACCCTCAATGGCCTGGGGAAAGGTGAAGAATCATACCCAGACCTTCTGGCTCTGTTGATCGCGGTCATCGTGACCATCATTGTTGCTCTGGGGGTGAAGAATTCCATAGGCTTCAACAATGTTCTCAATGTGCTGAACCTGGCAGTATGGGTGTTCATCATGATCGCAGGCCTCTTCTTCATCAATGGGAAATACTGGGCGGAGGGCCAGTTCTTGCCCCACGGCTGGTCAGGGGTGCTGCAAGGAGCAGCAACATGCTTCTACGCTTTCATTGGCTTTGACATCATCGCCACCACTGGAGAGGAAGCCAAGAATCCCAACACGTCCATCCCTTATGCTATCACTGCCTCCCTGGTCATCTGCCTGACAGCATATGTGTCTGTGAGCGTGATCTTAACTCTGATGGTGCCATATTATACCATTGACACGGAATCCCCACTCATGGAGATGTTTGTGGCTCATGGGTTCTATGCTGCCAAATTCGTAGTGGCCATTGGGTCGGTTGCAGGACTGACAGTCAGCTTGCTGGGGTCCCTCTTCCCGATGCCGAGGGTCATTTATGCCATGGCTGGTGACGGGCTCCTTTTCAGGTTCCTGGCTCACGTCAGCTCCTACACAGAGACACCAGTGGTGGCCTGCATCGTGTCGGGGTTCCTGGCAGCGCTCCTCGCACTGTTGGTCAGCTTGAGAGACCTGATAGAGATGATGTCTATCGGCACGCTCCTGGCCTACACCTTGGTCTCTGTCTGTGTCTTGCTCCTTCGATACCAACCTGAGAGTGACATTGATGGTTTTGTCAAGTTCTTGTCTGAGGAGCACACCAAGAAGAAGGAGGGCATTCTGGCTGACTGTGAGAAGGAAGCTTGTTCTCCTGTGAGTGAGGGGGATGAGTTTTCTGGCCCAGCCACCAACACATGTGGGGCCAAGAACTTACCATCCTTGGGAGACAATGAGATGCTCATAGGGAAATCAGACAAGTCAACCTACAACGTCAACCACCCCAATTACGGCACCGTGGACATGACCACAGGCATAGAAGCTGATGAATCCGAAAATATTTATCTCATCAAGTTAAAGAAGCTGATTGGGCCTCATTATTACACCATGAGAATCCGGCTGGGCCTTCCAGGCAAAATGGACCGGCCCACAGCAGCGACGGGGCACACGGTGACCATCTGCGTGCTCCTGCTCTTCATCCTCATGTTCATCTTCTGCTCCTTCATCATCTTTGGTTCTGACTACATCTCAGAGCAGAGCTGGTGGGCCATCCTTCTGGTTGTTCTGATGGTGCTGCTGATCAGCACCCTGGTGTTTGTGATCCTGCAGCAGCCAGAGAACCCCAAGAAGCTGCCCTACATGGCCCCTTGCCTCCCCTTTGTGCCTGCCTTTGCCATGCTGGTGAACATCTATCTCATGCTAAAGCTCTCCACCATCACATGGATCCGGTTTGCGGTCTGGTGCTTTGTGGGTCTGCTCATTTATTTTGGATATGGCATCTGGAACAGCACCCTGGAAATCAGCGCTCGAGAAGAGGCCCTGCACCAAAGCACGTACCAACGCTACGACGTGGATGACCCCTTCTCAGTGGAGGAGGGTTTCTCCTACGCCACAGAGGGCGAGAGCCAGGAGGACTGGGGCGGGCCCACTGAAGACAAAGGCTTCTATTACCAACAGATGTCAGATGCGAAGGCAAACGGCCGGACAAGTAGCAAAGCGAAGAGCAAAAGCAAACACAAACAGAACTCAGAGGCCCTGATTGCAAATGATGAGTTAGATTACTCTCCAGAGTAG

Back to List