Details for gene: SEMA4A


protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; semaphorin receptor binding : Interacting selectively and non-covalently with semaphorin receptors. ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; integral component of membrane : The component of a membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; plasma membrane : The membrane surrounding a cell that separates the cell from its external environment. It consists of a phospholipid bilayer and associated proteins. ; cell differentiation : The process in which relatively unspecialized cells, e.g. embryonic or regenerative cells, acquire specialized structural and/or functional features that characterize the cells, tissues, or organs of the mature organism or some other relatively stable phase of the organism's life history. Differentiation includes the processes involved in commitment of a cell to a specific fate and its subsequent development to the mature state. ; immune system process : Any process involved in the development or functioning of the immune system, an organismal system for calibrated responses to potential internal or invasive threats. ; nervous system development : The process whose specific outcome is the progression of nervous tissue over time, from its formation to its mature state. ; adaptive immune response : An immune response mediated by cells expressing specific receptors for antigen produced through a somatic diversification process, and allowing for an enhanced secondary response to subsequent exposures to the same antigen (immunological memory). ; angiogenesis : Blood vessel formation when new vessels emerge from the proliferation of pre-existing blood vessels. ; extracellular space : That part of a multicellular organism outside the cells proper, usually taken to be outside the plasma membranes, and occupied by fluid. ; integral component of plasma membrane : The component of the plasma membrane consisting of the gene products and protein complexes having at least some part of their peptide sequence embedded in the hydrophobic region of the membrane. ; positive regulation of excitatory synapse assembly : Any process that activates or increases the frequency, rate or extent of excitatory synapse assembly. ; chemorepellent activity : Providing the environmental signal that initiates the directed movement of a motile cell or organism towards a lower concentration of that signal. ; neural crest cell migration : The characteristic movement of cells from the dorsal ridge of the neural tube to a variety of locations in a vertebrate embryo. ; axon guidance : The chemotaxis process that directs the migration of an axon growth cone to a specific target site in response to a combination of attractive and repulsive cues. ; positive regulation of cell migration : Any process that activates or increases the frequency, rate or extent of cell migration. ; negative regulation of axon extension involved in axon guidance : Any process that stops, prevents, or reduces the frequency, rate or extent of axon extension involved in axon guidance. ; negative chemotaxis : The directed movement of a motile cell or organism towards a lower concentration of a chemical. ; semaphorin-plexin signaling pathway : A series of molecular signals generated as a consequence of a semaphorin receptor (composed of a plexin and a neurophilin) binding to a semaphorin ligand. ; positive regulation of inhibitory synapse assembly : Any process that activates or increases the frequency, rate or extent of inhibitory synapse assembly. ; T cell differentiation involved in immune response : The process in which an antigenically naive T cell acquires the specialized features of an effector, regulatory, or memory T cell as part of an immune response. Effector T cells include cells which provide T cell help or exhibit cytotoxicity towards other cells. ; axonogenesis : De novo generation of a long process of a neuron, including the terminal branched region. Refers to the morphogenesis or creation of shape or form of the developing axon, which carries efferent (outgoing) action potentials from the cell body towards target cells. ; regulation of cell shape : Any process that modulates the surface configuration of a cell. ; regulation of endothelial cell migration : Any process that modulates the rate, frequency, or extent of the orderly movement of an endothelial cell into the extracellular matrix to form an endothelium. ; negative regulation of angiogenesis : Any process that stops, prevents, or reduces the frequency, rate or extent of angiogenesis. ; T-helper 1 cell differentiation : The process in which a relatively unspecialized T cell acquires the specialized features of a T-helper 1 (Th1) cell. A Th1 cell is a CD4-positive, alpha-beta T cell that has the phenotype T-bet-positive and produces interferon-gamma. ;


Symbol
SEMA4A
Name
semaphorin 4A
Entrez ID
64218
Ensembl ID
ENSG00000196189    (more details)
KEGG ID
hsa:64218    (more details)
OMIM ID
607292
Uniprot ID
Q9H3S1  
GO ID
hsa:64218    (more details)
Chromosome
20
Strand
1
Start
63981132
End
64033100
miRNA Interactions
hsa-miR-182-5p (RPM: 77446.6216) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-203a-3p (RPM: 1346.5646) / hsa-miR-24-3p (RPM: 581.6226) / hsa-miR-628-5p (RPM: 28.0514) / hsa-miR-2278 (RPM: 0.0896) / hsa-miR-146a-5p (RPM: 774.8698) / hsa-miR-423-3p (RPM: 1928.5158) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Axon guidance /
Sequence
ATGGCCCTCCCAGCCCTGGGCCTGGACCCCTGGAGCCTCCTGGGCCTTTTCCTCTTCCAACTGCTTCAGCTGCTGCTGCCGACGACGACCGCGGGGGGAGGCGGGCAGGGGCCCATGCCCAGGGTCAGATACTATGCAGGGGATGAACGTAGGGCACTTAGCTTCTTCCACCAGAAGGGCCTCCAGGATTTTGACACTCTGCTCCTGAGTGGTGATGGAAATACTCTCTACGTGGGGGCTCGAGAAGCCATTCTGGCCTTGGATATCCAGGATCCAGGGGTCCCCAGGCTAAAGAACATGATACCGTGGCCAGCCAGTGACAGAAAAAAGAGTGAATGTGCCTTTAAGAAGAAGAGCAATGAGACACAGTGTTTCAACTTCATCCGTGTCCTGGTTTCTTACAATGTCACCCATCTCTACACCTGCGGCACCTTCGCCTTCAGCCCTGCTTGTACCTTCATTGAACTTCAAGATTCCTACCTGTTGCCCATCTCGGAGGACAAGGTCATGGAGGGAAAAGGCCAAAGCCCCTTTGACCCCGCTCACAAGCATACGGCTGTCTTGGTGGATGGGATGCTCTATTCTGGTACTATGAACAACTTCCTGGGCAGTGAGCCCATCCTGATGCGCACACTGGGATCCCAGCCTGTCCTCAAGACCGACAACTTCCTCCGCTGGCTGCATCATGACGCCTCCTTTGTGGCAGCCATCCCTTCGACCCAGGTCGTCTACTTCTTCTTCGAGGAGACAGCCAGCGAGTTTGACTTCTTTGAGAGGCTCCACACATCGCGGGTGGCTAGAGTCTGCAAGAATGACGTGGGCGGCGAAAAGCTGCTGCAGAAGAAGTGGACCACCTTCCTGAAGGCCCAGCTGCTCTGCACCCAGCCGGGGCAGCTGCCCTTCAACGTCATCCGCCACGCGGTCCTGCTCCCCGCCGATTCTCCCACAGCTCCCCACATCTACGCAGTCTTCACCTCCCAGTGGCAGGTTGGCGGGACCAGGAGCTCTGCGGTTTGTGCCTTCTCTCTCTTGGACATTGAACGTGTCTTTAAGGGGAAATACAAAGAGTTGAACAAAGAAACTTCACGCTGGACTACTTATAGGGGCCCTGAGACCAACCCCCGGCCAGGCAGTTGCTCAGTGGGCCCCTCCTCTGATAAGGCCCTGACCTTCATGAAGGACCATTTCCTGATGGATGAGCAAGTGGTGGGGACGCCCCTGCTGGTGAAATCTGGCGTGGAGTATACACGGCTTGCAGTGGAGACAGCCCAGGGCCTTGATGGGCACAGCCATCTTGTCATGTACCTGGGAACCACCACAGGGTCGCTCCACAAGGCTGTGGTAAGTGGGGACAGCAGTGCTCATCTGGTGGAAGAGATTCAGCTGTTCCCTGACCCTGAACCTGTTCGCAACCTGCAGCTGGCCCCCACCCAGGGTGCAGTGTTTGTAGGCTTCTCAGGAGGTGTCTGGAGGGTGCCCCGAGCCAACTGTAGTGTCTATGAGAGCTGTGTGGACTGTGTCCTTGCCCGGGACCCCCACTGTGCCTGGGACCCTGAGTCCCGAACCTGTTGCCTCCTGTCTGCCCCCAACCTGAACTCCTGGAAGCAGGACATGGAGCGGGGGAACCCAGAGTGGGCATGTGCCAGTGGCCCCATGAGCAGGAGCCTTCGGCCTCAGAGCCGCCCGCAAATCATTAAAGAAGTCCTGGCTGTCCCCAACTCCATCCTGGAGCTCCCCTGCCCCCACCTGTCAGCCTTGGCCTCTTATTATTGGAGTCATGGCCCAGCAGCAGTCCCAGAAGCCTCTTCCACTGTCTACAATGGCTCCCTCTTGCTGATAGTGCAGGATGGAGTTGGGGGTCTCTACCAGTGCTGGGCAACTGAGAATGGCTTTTCATACCCTGTGATCTCCTACTGGGTGGACAGCCAGGACCAGACCCTGGCCCTGGATCCTGAACTGGCAGGCATCCCCCGGGAGCATGTGAAGGTCCCGTTGACCAGGGTCAGTGGTGGGGCCGCCCTGGCTGCCCAGCAGTCCTACTGGCCCCACTTTGTCACTGTCACTGTCCTCTTTGCCTTAGTGCTTTCAGGAGCCCTCATCATCCTCGTGGCCTCCCCATTGAGAGCACTCCGGGCTCGGGGCAAGGTTCAGGGCTGTGAGACCCTGCGCCCTGGGGAGAAGGCCCCGTTAAGCAGAGAGCAACACCTCCAGTCTCCCAAGGAATGCAGGACCTCTGCCAGTGATGTGGACGCTGACAACAACTGCCTAGGCACTGAGGTAGCTTAA

Back to List