Details for gene: ZNF408


nucleus : A membrane-bounded organelle of eukaryotic cells in which chromosomes are housed and replicated. In most cells, the nucleus contains all of the cell's chromosomes except the organellar chromosomes, and is the site of RNA synthesis and processing. In some species, or in specialized cell types, RNA metabolism or DNA replication may be absent. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; DNA binding : Any molecular function by which a gene product interacts selectively and non-covalently with DNA (deoxyribonucleic acid). ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; regulation of transcription by RNA polymerase II : Any process that modulates the frequency, rate or extent of transcription mediated by RNA polymerase II. ; identical protein binding : Interacting selectively and non-covalently with an identical protein or proteins. ; DNA-binding transcription factor activity, RNA polymerase II-specific : A DNA-binding transcription factor activity that modulates the transcription of specific gene sets transcribed by RNA polymerase II. ; RNA polymerase II cis-regulatory region sequence-specific DNA binding : Interacting selectively and non-covalently with a specific upstream regulatory DNA sequence (transcription factor recognition sequence or binding site) located in cis relative to the transcription start site (i.e., on the same strand of DNA) of a gene transcribed by RNA polymerase II. ;


Symbol
ZNF408
Name
zinc finger protein 408
Entrez ID
79797
Ensembl ID
ENSG00000175213    (more details)
KEGG ID
hsa:79797    (more details)
OMIM ID
616454
Uniprot ID
B4DXY4  
GO ID
hsa:79797    (more details)
Chromosome
10
Strand
1
Start
24848614
End
24952606
miRNA Interactions
hsa-miR-27b-3p (RPM: 22876.2392) / hsa-miR-27a-3p (RPM: 980.3062) / hsa-miR-339-5p (RPM: 44.716) / hsa-miR-148a-3p (RPM: 10339.6222) / hsa-miR-130a-3p (RPM: 723.372) / hsa-miR-148b-3p (RPM: 970.7614) / hsa-miR-140-3p (RPM: 779.3088) / hsa-miR-342-3p (RPM: 685.7862) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-191-5p (RPM: 12993.8088) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Sequence
ATGGAGGAGGCGGAGGAGCTGCTCTTGGAGGGGAAGAAGGCGCTGCAACTCGCCCGCGAGCCGCGCCTGGGCCTGGACTTAGGATGGAACCCTTCCGGAGAAGGCTGTACGCAGGGCCTCAAAGACGTCCCACCCGAGCCGACCCGAGACATCCTCGCTTTAAAGAGCCTTCCCCGGGGCTTGGCCCTTGGCCCCTCACTCGCCAAGGAACAGCGCTTGGGGGTCTGGTGTGTCGGGGACCCCCTGCAGCCCGGCCTGCTGTGGGGGCCGCTGGAAGAGGAGTCTGCCTCCAAGGAGAAGGGCGAGGGAGTAAAGCCACGGCAGGAGGAGAACCTGTCATTAGGCCCATGGGGAGACGTGTGTGCCTGTGAGCAGAGTTCTGGCTGGACTAGCTTGGTACAACGGGGCAGGCTGGAGAGTGAGGGAAATGTGGCCCCAGTGCGGATCAGCGAGAGGCTTCATCTGCAAGTGTACCAGCTGGTGCTGCCAGGCTCTGAACTGCTGCTGTGGCCCCAGCCTTCCTCTGAGGGCCCAAGTCTCACCCAGCCTGGGCTGGACAAAGAGGCAGCTGTAGCAGTGGTGACAGAAGTGGAGTCTGCTGTACAGCAGGAAGTGGCCTCCCCTGGGGAGGATGCAGCAGAACCTTGCATAGATCCTGGTTCCCAGTCACCCTCTGGCATCCAGGCAGAGAATATGGTGAGCCCTGGACTTAAGTTCCCAACCCAGGACCGAATTTCCAAGGATAGCCAGCCACTTGGCCCATTGCTTCAGGATGGCGACGTGGATGAGGAATGCCCGGCCCAGGCACAGATGCCACCTGAACTTCAGAGCAATTCGGCTACCCAGCAGGACCCAGATGGCAGTGGAGCCAGTTTCTCATCTTCTGCCAGGGGCACCCAGCCGCATGGCTACCTGGCCAAGAAGTTACACAGCCCCAGTGATCAGTGCCCACCCAGAGCAAAGACCCCAGAGCCTGGAGCCCAGCAGTCTGGCTTCCCTACACTCTCGCGGAGCCCTCCTGGCCCAGCAGGAAGCTCCCCAAAGCAGGGGCGACGGTACCGGTGTGGAGAGTGTGGCAAGGCATTCCTACAGCTGTGCCACCTAAAGAAGCACGCATTTGTGCACACGGGCCACAAGCCCTTTCTTTGCACTGAGTGTGGCAAGAGCTATAGCTCAGAGGAGAGCTTCAAAGCCCATATGCTGGGCCACCGTGGGGTGCGGCCCTTCCCCTGTCCACAATGCGACAAGGCCTATGGCACCCAGCGAGACCTCAAAGAGCACCAGGTGGTACATTCAGGTGCCCGGCCCTTTGCTTGTGACCAGTGTGGCAAGGCCTTTGCCCGCCGGCCCTCCCTGCGGCTGCATCGCAAGACCCACCAGGTGCCAGCTGCCCCTGCCCCTTGCCCATGCCCTGTGTGTGGGCGGCCCCTGGCCAACCAGGGCTCCCTGCGGAACCATATGAGGCTCCATACAGGAGAAAAGCCTTTCCTGTGCCCGCACTGTGGCCGGGCGTTTCGTCAGCGGGGCAACCTGCGTGGGCATTTGCGGCTCCACACCGGGGAGCGTCCTTACCGCTGCCCACACTGTGCCGATGCCTTCCCCCAGCTGCCTGAACTGCGGCGCCATCTCATCTCACACACCGGGGAGGCCCACTTGTGCCCGGTGTGTGGCAAGGCCCTCCGAGACCCACACACGCTCCGAGCTCACGAGCGCCTGCACTCCGGAGAGAGGCCCTTTCCCTGTCCCCAGTGTGGCCGTGCTTACACGCTGGCCACCAAGCTGCGGCGCCACCTCAAATCTCACTTGGAGGACAAGCCCTACCGCTGCCCCACCTGTGGCATGGGCTACACCCTCCCGCAGAGCCTCAGGCGGCATCAGCTCAGTCACCGGCCTGAGGCACCCTGCAGCCCACCCTCTGTGCCTTCTGCTGCTTCTGAGCCCACTGTGGTGCTCCTGCAGGCTGAGCCACAACTGCTGGACACACACAGAGAGGAGGAAGTCTCCCCCGCCAGGGATGTTGTTGAGGTCACCATTTCAGAAAGCCAGGAGAAGTGCTTTGTGGTGCCAGAGGAGCCAGATGCCGCCCCCAGCCTGGTGCTAATCCATAAGGACATGGGCCTCGGCGCCTGGGCAGAGGTGGTGGAGGTGGAGATGGGCACCTGA

Back to List