Details for gene: DHDDS


transferase activity : Catalysis of the transfer of a group, e.g. a methyl group, glycosyl group, acyl group, phosphorus-containing, or other groups, from one compound (generally regarded as the donor) to another compound (generally regarded as the acceptor). Transferase is the systematic name for any enzyme of EC class 2. ; transferase activity, transferring alkyl or aryl (other than methyl) groups : Catalysis of the transfer of an alkyl or aryl (but not methyl) group from one compound (donor) to another (acceptor). ; membrane : A lipid bilayer along with all the proteins and protein complexes embedded in it an attached to it. ; metal ion binding : Interacting selectively and non-covalently with any metal ion. ; endoplasmic reticulum : The irregular network of unit membranes, visible only by electron microscopy, that occurs in the cytoplasm of many eukaryotic cells. The membranes form a complex meshwork of tubular channels, which are often expanded into slitlike cavities called cisternae. The ER takes two forms, rough (or granular), with ribosomes adhering to the outer surface, and smooth (with no ribosomes attached). ; endoplasmic reticulum membrane : The lipid bilayer surrounding the endoplasmic reticulum. ; lipid metabolic process : The chemical reactions and pathways involving lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent. Includes fatty acids; neutral fats, other fatty-acid esters, and soaps; long-chain (fatty) alcohols and waxes; sphingoids and other long-chain bases; glycolipids, phospholipids and sphingolipids; and carotenes, polyprenols, sterols, terpenes and other isoprenoids. ; protein binding : Interacting selectively and non-covalently with any protein or protein complex (a complex of two or more proteins that may include other nonprotein molecules). ; protein glycosylation : A protein modification process that results in the addition of a carbohydrate or carbohydrate derivative unit to a protein amino acid, e.g. the addition of glycan chains to proteins. ; polyprenyltransferase activity : Catalysis of the transfer of multiple prenyl groups from one compound (donor) to another (acceptor). ; dehydrodolichyl diphosphate synthase activity : Catalysis of the condensation of isopentenyl diphosphate and farnesyl diphosphate in the cis-configuration to form dehydrodolichyl diphosphate. ; dolichyl diphosphate biosynthetic process : The chemical reactions and pathways resulting in the formation of dolichyl diphosphate, a diphosphorylated dolichol derivative. ; polyprenol biosynthetic process : The chemical reactions and pathways resulting in the formation of polyprenols, prenols with more than 4 isoprenoid residues, which may be all-trans, or a mixture of cis and trans. ; dehydrodolichyl diphosphate synthase complex : A protein complex which is capable of dehydrodolichyl diphosphate synthase activity. ;


Symbol
DHDDS
Name
dehydrodolichyl diphosphate synthase subunit
Entrez ID
79947
Ensembl ID
ENSG00000117682    (more details)
KEGG ID
hsa:79947    (more details)
OMIM ID
608172
Uniprot ID
Q86SQ9  
GO ID
hsa:79947    (more details)
Chromosome
14
Strand
1
Start
67701886
End
67734451
miRNA Interactions
hsa-miR-20a-5p (RPM: 55.9816) / hsa-miR-124-3p (RPM: 4110.4386) / hsa-miR-106b-5p (RPM: 35.4204) / hsa-miR-106a-5p (RPM: 7.9736) / hsa-miR-582-3p (RPM: 12.5308) / hsa-miR-186-5p (RPM: 1645.2832) / hsa-miR-328-3p (RPM: 137.931) / hsa-miR-143-3p (RPM: 93089.5152) / hsa-miR-4728-5p (RPM: 0.1204) / hsa-miR-18a-5p (RPM: 3.6074) / hsa-miR-5008-5p (RPM: 0.0186) / hsa-miR-1343-3p (RPM: 3.6608) / hsa-miR-30c-2-3p (RPM: 52.8714) / hsa-miR-30b-3p (RPM: 13.9872) / hsa-miR-3913-5p (RPM: 2.6744) / hsa-miR-149-3p (RPM: 0.3876) / hsa-miR-22-5p (RPM: 21.6092) / hsa-miR-450a-1-3p (RPM: 0.0026) / hsa-miR-30c-1-3p (RPM: 36.5546) / hsa-miR-93-5p (RPM: 357.1536) / hsa-miR-17-5p (RPM: 83.6404) / hsa-miR-1913 (RPM: 0.4166) / hsa-miR-4710 (RPM: 0.0186) / hsa-miR-1468-5p (RPM: 35.4058) / hsa-miR-522-5p (RPM: 0.0018) / hsa-miR-10b-5p (RPM: 14052.6542) / hsa-miR-10a-5p (RPM: 408.7974) / hsa-miR-6785-5p (RPM: 0.0412) / hsa-miR-6883-5p (RPM: 0.0016) / hsa-miR-7106-5p (RPM: 0.007) / hsa-miR-887-5p (RPM: 3.285) / hsa-miR-1273h-5p (RPM: 0.1102) / hsa-miR-6780a-5p (RPM: 0.2598) / hsa-miR-6779-5p (RPM: 0.1952) / hsa-miR-6799-5p (RPM: 0.0034) / hsa-miR-6804-5p (RPM: 0.106) / hsa-miR-6513-5p (RPM: 0.1884) / hsa-miR-6089 (RPM: 0.0044) /
Involved Diseases
Retinitis pigmentosa (RP) /
Involved Pathways
Terpenoid backbone biosynthesis, /
Sequence
ATGTCATGGATCAAGGAAGGAGAGCTGTCACTTTGGGAGCGGTTCTGTGCCAACATCATAAAGGCAGGCCCAATGCCGAAACACATTGCATTCATAATGGACGGGAACCGTCGCTATGCCAAGAAGTGCCAGGTGGAGCGGCAGGAAGGCCACTCACAGGGCTTCAACAAGCTAGCTGAGACTCTGCGGTGGTGTTTGAACCTGGGCATCCTAGAGGTGACAGTCTACGCATTCAGCATTGAGAACTTCAAACGCTCCAAGAGTGAGGTAGACGGGCTTATGGATCTGGCCCGGCAGAAGTTCAGCCGCTTGATGGAAGAAAAGGAGAAACTGCAGAAGCATGGGGTGTGTATCCGGGTCCTGGGCGATCTGCACTTGTTGCCCTTGGATCTCCAGGAGCTGATTGCACAAGCTGTACAGGCCACGAAGAACTACAACAAGTGTTTCCTGAATGTCTGTTTTGCATACACATCCCGTCATGAGATCAGCAATGCTGTGAGAGAGATGGCCTGGGGGGTGGAGCAAGGCCTGTTGGATCCCAGTGATATCTCTGAGTCTCTGCTTGATAAGTGCCTCTATACCAACCGCTCTCCTCATCCTGACATCTTGATACGGACTTCTGGAGAAGTGCGGCTGAGTGACTTCTTGCTATGGCAGACCTCTCACTCCTGCCTGGTGTTCCAACCCGTTCTGTGGCCAGAGTATACATTTTGGAACCTCTTCGAGGCCATCCTGCAGTTCCAGATGAACCATAGCGTGCTTCAGAAGGCCCGAGACATGTATGCAGAGGAGCGGAAGAGGCAGCAGCTGGAGAGGGACCAGGCTACAGTGACAGAGCAGCTGCTGCGAGAGGGGCTCCAAGCCAGTGGGGACGCCCAGCTCCGAAGGACACGCTTGCACAAACTCTCGGCCAGACGGGAAGAGCGAGTCCAAGGCTTCCTGCAGGCCTTGGAACTCAAGCGAGCTGACTGGCTGGCCCGTCTGGGCACTGCATCAGCCTGA

Back to List